Incidental Mutation 'R8262:Pxdn'
ID639876
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R8262 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 29999196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 620 (Y620*)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328]
Predicted Effect probably null
Transcript: ENSMUST00000122328
AA Change: Y620*
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: Y620*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,107,710 D358G possibly damaging Het
Adam26a A T 8: 43,569,141 C437* probably null Het
Arhgap10 A T 8: 77,310,839 C587S probably benign Het
Bank1 G A 3: 136,242,960 T285I probably benign Het
Bhlha15 C T 5: 144,191,439 S123L probably damaging Het
Cacul1 T C 19: 60,529,037 *305W probably null Het
Cep112 A C 11: 108,503,151 K365T probably damaging Het
Chrm1 T A 19: 8,679,089 L386Q probably damaging Het
Cnbp C A 6: 87,845,212 R110L probably damaging Het
Cntnap5a A T 1: 116,188,410 I541F possibly damaging Het
Dscaml1 T G 9: 45,747,140 probably benign Het
Enpp3 C T 10: 24,777,926 S711N probably damaging Het
Eps8 G T 6: 137,482,254 N750K probably benign Het
Fan1 G T 7: 64,373,306 N66K probably benign Het
Fbf1 G A 11: 116,154,019 T323I probably benign Het
Flg2 A T 3: 93,220,210 N2143I unknown Het
Fn3k A C 11: 121,448,918 T169P probably benign Het
Fubp1 T G 3: 152,220,719 I320R probably damaging Het
Gfpt2 A T 11: 49,823,780 E335D probably benign Het
Gm13762 T G 2: 88,973,208 S228R probably damaging Het
Gm17472 T C 6: 42,981,034 I79T probably benign Het
Gpr151 C A 18: 42,578,372 E414* probably null Het
Gpr179 G A 11: 97,336,157 S1724L probably benign Het
Gtf2h3 C A 5: 124,590,904 Y175* probably null Het
Hal T A 10: 93,492,507 I215N probably damaging Het
Htt A G 5: 34,895,960 T2546A probably benign Het
Ighv1-11 T C 12: 114,612,457 Y46C probably damaging Het
Lcn4 T C 2: 26,668,363 D170G probably benign Het
Lrch1 T A 14: 74,818,495 D306V probably damaging Het
Mtcl1 A C 17: 66,343,658 V1604G probably damaging Het
Olfr1299 T G 2: 111,664,242 N5K possibly damaging Het
Olfr139 A G 11: 74,045,100 L58P probably damaging Het
Olfr1505 G A 19: 13,919,862 V281I probably benign Het
Olfr1513 T C 14: 52,349,168 N293D probably damaging Het
Ormdl2 A G 10: 128,818,968 L125P possibly damaging Het
Papd4 T C 13: 93,174,489 probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde3a T A 6: 141,487,801 F803Y possibly damaging Het
Pnpla7 C T 2: 24,983,623 R214W probably damaging Het
Prtg T C 9: 72,906,238 V960A probably benign Het
Ptgdr T C 14: 44,853,401 E300G probably benign Het
Ptpru G T 4: 131,794,963 Y710* probably null Het
Pycard T C 7: 127,993,625 D10G possibly damaging Het
Sh3d21 G T 4: 126,161,982 Q160K probably benign Het
Slc26a7 G A 4: 14,621,269 P39L probably benign Het
Snrnp200 T A 2: 127,227,008 Y936N probably damaging Het
Sox8 T C 17: 25,567,643 D362G possibly damaging Het
Tcp11 T G 17: 28,067,027 N538T probably damaging Het
Tmem132e A C 11: 82,434,840 E222A probably benign Het
Trpc7 T C 13: 56,789,789 E618G probably benign Het
Tsc2 G T 17: 24,614,366 Q695K probably benign Het
Txlnb C A 10: 17,843,004 L528M possibly damaging Het
Vmn1r176 A G 7: 23,835,453 Y92H probably benign Het
Vmn2r85 T A 10: 130,418,869 I649F probably damaging Het
Vwa8 T C 14: 78,933,832 probably null Het
Wrn A T 8: 33,324,246 I390N probably benign Het
Zfp493 T A 13: 67,786,857 C310S probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGTTGGTTCAGCAAGCAG -3'
(R):5'- TGGCTTGCACATGAATGTTCTTAG -3'

Sequencing Primer
(F):5'- TGTTGGTTCAGCAAGCAGAAATAGC -3'
(R):5'- GCACATGAATGTTCTTAGGACTTG -3'
Posted On2020-07-28