Incidental Mutation 'R8261:Adam23'
ID639893
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8261 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63528798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 202 (V202A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably benign
Transcript: ENSMUST00000087374
AA Change: V202A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: V202A

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114103
AA Change: V202A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: V202A

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114107
AA Change: V202A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: V202A

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
AA Change: V202A
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964
AA Change: V202A

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,110,343 S75C probably damaging Het
4933412E24Rik T C 15: 60,016,576 E5G probably benign Het
5730559C18Rik T A 1: 136,225,477 N226Y probably damaging Het
Adamtsl1 A C 4: 86,276,883 E512D probably damaging Het
Ahnak A T 19: 9,005,453 D1367V probably damaging Het
Angpt4 A T 2: 151,927,164 Q198L probably benign Het
Apcdd1 T A 18: 62,933,903 H29Q possibly damaging Het
Cdh16 T A 8: 104,615,179 K755* probably null Het
Cdk6 T G 5: 3,390,685 F80V probably benign Het
Chd1 T C 17: 17,387,542 S451P probably benign Het
Chd6 A G 2: 160,957,082 L2361P probably damaging Het
Chst8 A G 7: 34,748,154 M13T possibly damaging Het
Cntnap2 T C 6: 47,095,693 L1065P probably damaging Het
Dctn4 T C 18: 60,526,271 V14A possibly damaging Het
Dicer1 A T 12: 104,691,606 V1903D probably damaging Het
E2f2 A G 4: 136,184,480 silent Het
Eif4g3 T A 4: 138,171,118 S902T possibly damaging Het
Emid1 G T 11: 5,134,353 A152D probably benign Het
Fer1l6 T A 15: 58,560,496 N297K possibly damaging Het
Fes T C 7: 80,383,154 D281G probably null Het
Fry A G 5: 150,445,907 Y2282C probably damaging Het
Gm10377 C T 14: 42,794,707 probably null Het
Gm1527 A G 3: 28,920,600 T521A probably damaging Het
Gm626 T C 14: 33,502,977 V133A probably benign Het
Gpr141 T A 13: 19,751,843 H254L probably benign Het
Gpr160 A G 3: 30,895,947 E56G probably benign Het
Grid2ip T G 5: 143,381,940 probably null Het
Grin2a A G 16: 9,663,518 F473S probably damaging Het
Igkv1-131 T C 6: 67,766,118 T94A probably damaging Het
Iqgap2 A G 13: 95,635,570 L1367P probably damaging Het
Kdm5d T A Y: 936,929 M856K probably damaging Het
Kirrel T C 3: 87,088,002 probably benign Het
Lad1 T C 1: 135,827,762 S259P probably damaging Het
Lalba A T 15: 98,482,111 F86Y possibly damaging Het
Lrfn5 G A 12: 61,839,537 C37Y probably damaging Het
Man2c1 A G 9: 57,139,658 T665A probably benign Het
Myh11 T C 16: 14,224,003 I719V Het
Nbl1 A T 4: 139,085,521 C34S probably damaging Het
Ncapg T A 5: 45,687,388 I575N possibly damaging Het
Nlgn1 T C 3: 25,433,652 T840A possibly damaging Het
Nrd1 T C 4: 109,016,679 S231P possibly damaging Het
Nrg2 T C 18: 36,032,375 K395E probably benign Het
Nrip1 A T 16: 76,292,061 N869K possibly damaging Het
Olfr1259 A G 2: 89,943,372 F248L probably benign Het
Olfr237-ps1 T A 6: 43,153,308 M1K probably null Het
Olfr285 A T 15: 98,312,665 M295K probably benign Het
Otub2 G T 12: 103,402,902 probably null Het
Paxbp1 T C 16: 91,037,415 D161G probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Per2 T A 1: 91,433,448 Q495L possibly damaging Het
Plxna2 T A 1: 194,749,416 V571E probably damaging Het
Prr7 C A 13: 55,472,922 P248T possibly damaging Het
Ptprr A T 10: 116,237,264 T464S possibly damaging Het
Rapgef2 A G 3: 79,086,018 V721A probably benign Het
Rfx1 A T 8: 84,092,850 Y625F probably benign Het
Rps6kb2 G T 19: 4,161,196 A110D possibly damaging Het
Setdb2 A T 14: 59,413,692 probably benign Het
Slc25a31 T C 3: 40,724,920 I272T probably damaging Het
Smpd1 T C 7: 105,555,313 V133A probably benign Het
Sorl1 T C 9: 42,014,481 D1185G probably damaging Het
Spag6 T A 2: 18,745,490 L449H probably benign Het
Sptb C A 12: 76,621,262 R687L probably benign Het
Sptbn5 A T 2: 120,047,135 V1012E noncoding transcript Het
Tmem192 A G 8: 64,964,320 I188V probably benign Het
Tmem253 G A 14: 52,019,251 V194M probably benign Het
Tph1 A G 7: 46,653,749 silent Het
Trak1 A G 9: 121,451,667 E374G probably damaging Het
Trpv1 A T 11: 73,254,767 probably null Het
Trub2 T C 2: 29,777,713 H305R probably benign Het
Ttn A G 2: 76,917,424 V4427A probably benign Het
Vasn A G 16: 4,648,296 T36A probably damaging Het
Vmn1r8 A T 6: 57,036,173 I70F probably benign Het
Vps13c A T 9: 67,954,980 I2960L probably damaging Het
Zdhhc4 C A 5: 143,321,833 M144I probably benign Het
Zfp273 T A 13: 67,825,951 N399K probably benign Het
Zfp976 T A 7: 42,612,701 T572S unknown Het
Zmym4 A G 4: 126,904,567 C756R probably damaging Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATGCGAACTTTATCCTTTAC -3'
(R):5'- TAGTCCTCAACATATCACTGGC -3'

Sequencing Primer
(F):5'- CATGCGAACTTTATCCTTTACATTGG -3'
(R):5'- TCAACATATCACTGGCATAGAAAAG -3'
Posted On2020-07-28