Mutagenetix > Incidental Mutations

Incidental Mutation 'R8261:Adamtsl1'

639910

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R8261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 86276883 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 512 (E512D)

Ref Sequence

ENSEMBL: ENSMUSP00000102796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

probably damaging
Transcript: ENSMUST00000107178
AA Change: E512D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: E512D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141889
AA Change: E529D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: E529D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,110,343	S75C	probably damaging	Het
4933412E24Rik	T	C	15: 60,016,576	E5G	probably benign	Het
5730559C18Rik	T	A	1: 136,225,477	N226Y	probably damaging	Het
Adam23	T	C	1: 63,528,798	V202A	noncoding transcript	Het
Ahnak	A	T	19: 9,005,453	D1367V	probably damaging	Het
Angpt4	A	T	2: 151,927,164	Q198L	probably benign	Het
Apcdd1	T	A	18: 62,933,903	H29Q	possibly damaging	Het
Cdh16	T	A	8: 104,615,179	K755*	probably null	Het
Cdk6	T	G	5: 3,390,685	F80V	probably benign	Het
Chd1	T	C	17: 17,387,542	S451P	probably benign	Het
Chd6	A	G	2: 160,957,082	L2361P	probably damaging	Het
Chst8	A	G	7: 34,748,154	M13T	possibly damaging	Het
Cntnap2	T	C	6: 47,095,693	L1065P	probably damaging	Het
Dctn4	T	C	18: 60,526,271	V14A	possibly damaging	Het
Dicer1	A	T	12: 104,691,606	V1903D	probably damaging	Het
E2f2	A	G	4: 136,184,480		silent	Het
Eif4g3	T	A	4: 138,171,118	S902T	possibly damaging	Het
Emid1	G	T	11: 5,134,353	A152D	probably benign	Het
Fer1l6	T	A	15: 58,560,496	N297K	possibly damaging	Het
Fes	T	C	7: 80,383,154	D281G	probably null	Het
Fry	A	G	5: 150,445,907	Y2282C	probably damaging	Het
Gm10377	C	T	14: 42,794,707		probably null	Het
Gm1527	A	G	3: 28,920,600	T521A	probably damaging	Het
Gm626	T	C	14: 33,502,977	V133A	probably benign	Het
Gpr141	T	A	13: 19,751,843	H254L	probably benign	Het
Gpr160	A	G	3: 30,895,947	E56G	probably benign	Het
Grid2ip	T	G	5: 143,381,940		probably null	Het
Grin2a	A	G	16: 9,663,518	F473S	probably damaging	Het
Igkv1-131	T	C	6: 67,766,118	T94A	probably damaging	Het
Iqgap2	A	G	13: 95,635,570	L1367P	probably damaging	Het
Kdm5d	T	A	Y: 936,929	M856K	probably damaging	Het
Kirrel	T	C	3: 87,088,002		probably benign	Het
Lad1	T	C	1: 135,827,762	S259P	probably damaging	Het
Lalba	A	T	15: 98,482,111	F86Y	possibly damaging	Het
Lrfn5	G	A	12: 61,839,537	C37Y	probably damaging	Het
Man2c1	A	G	9: 57,139,658	T665A	probably benign	Het
Myh11	T	C	16: 14,224,003	I719V		Het
Nbl1	A	T	4: 139,085,521	C34S	probably damaging	Het
Ncapg	T	A	5: 45,687,388	I575N	possibly damaging	Het
Nlgn1	T	C	3: 25,433,652	T840A	possibly damaging	Het
Nrd1	T	C	4: 109,016,679	S231P	possibly damaging	Het
Nrg2	T	C	18: 36,032,375	K395E	probably benign	Het
Nrip1	A	T	16: 76,292,061	N869K	possibly damaging	Het
Olfr1259	A	G	2: 89,943,372	F248L	probably benign	Het
Olfr237-ps1	T	A	6: 43,153,308	M1K	probably null	Het
Olfr285	A	T	15: 98,312,665	M295K	probably benign	Het
Otub2	G	T	12: 103,402,902		probably null	Het
Paxbp1	T	C	16: 91,037,415	D161G	probably benign	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Per2	T	A	1: 91,433,448	Q495L	possibly damaging	Het
Plxna2	T	A	1: 194,749,416	V571E	probably damaging	Het
Prr7	C	A	13: 55,472,922	P248T	possibly damaging	Het
Ptprr	A	T	10: 116,237,264	T464S	possibly damaging	Het
Rapgef2	A	G	3: 79,086,018	V721A	probably benign	Het
Rfx1	A	T	8: 84,092,850	Y625F	probably benign	Het
Rps6kb2	G	T	19: 4,161,196	A110D	possibly damaging	Het
Setdb2	A	T	14: 59,413,692		probably benign	Het
Slc25a31	T	C	3: 40,724,920	I272T	probably damaging	Het
Smpd1	T	C	7: 105,555,313	V133A	probably benign	Het
Sorl1	T	C	9: 42,014,481	D1185G	probably damaging	Het
Spag6	T	A	2: 18,745,490	L449H	probably benign	Het
Sptb	C	A	12: 76,621,262	R687L	probably benign	Het
Sptbn5	A	T	2: 120,047,135	V1012E	noncoding transcript	Het
Tmem192	A	G	8: 64,964,320	I188V	probably benign	Het
Tmem253	G	A	14: 52,019,251	V194M	probably benign	Het
Tph1	A	G	7: 46,653,749		silent	Het
Trak1	A	G	9: 121,451,667	E374G	probably damaging	Het
Trpv1	A	T	11: 73,254,767		probably null	Het
Trub2	T	C	2: 29,777,713	H305R	probably benign	Het
Ttn	A	G	2: 76,917,424	V4427A	probably benign	Het
Vasn	A	G	16: 4,648,296	T36A	probably damaging	Het
Vmn1r8	A	T	6: 57,036,173	I70F	probably benign	Het
Vps13c	A	T	9: 67,954,980	I2960L	probably damaging	Het
Zdhhc4	C	A	5: 143,321,833	M144I	probably benign	Het
Zfp273	T	A	13: 67,825,951	N399K	probably benign	Het
Zfp976	T	A	7: 42,612,701	T572S	unknown	Het
Zmym4	A	G	4: 126,904,567	C756R	probably damaging	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense
R7908:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R7934:Adamtsl1	UTSW	4	86243725	missense	probably damaging	1.00
R8056:Adamtsl1	UTSW	4	86342032	missense	possibly damaging	0.76
R8109:Adamtsl1	UTSW	4	86248069	missense
R8143:Adamtsl1	UTSW	4	86342255	missense	possibly damaging	0.71
R8205:Adamtsl1	UTSW	4	86199413	makesense	probably null
R8215:Adamtsl1	UTSW	4	86343145	missense	probably benign	0.45
R8250:Adamtsl1	UTSW	4	86342609	missense	probably damaging	1.00
R8417:Adamtsl1	UTSW	4	86156689	missense	possibly damaging	0.81
R8494:Adamtsl1	UTSW	4	86321984	missense	probably damaging	0.99
R8516:Adamtsl1	UTSW	4	86342543	missense	probably damaging	1.00
R8525:Adamtsl1	UTSW	4	86277010	missense	probably damaging	1.00
Z1176:Adamtsl1	UTSW	4	86342177	missense	probably damaging	0.99
Z1176:Adamtsl1	UTSW	4	86342693	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- AGTGGCCAATGAGCTCATG -3'
(R):5'- AGAGTCCGTCTCCGTTATCC -3'

Sequencing Primer
(F):5'- GCTCATGAACTAAAGTGAAGCTGCC -3'
(R):5'- GGGTTAAATTCCGGAGTTTCCCC -3'

Posted On

2020-07-28