Incidental Mutation 'R8261:Adamtsl1'
ID639910
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R8261 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86276883 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 512 (E512D)
Ref Sequence ENSEMBL: ENSMUSP00000102796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]
Predicted Effect probably damaging
Transcript: ENSMUST00000107178
AA Change: E512D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: E512D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141889
AA Change: E529D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: E529D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,110,343 S75C probably damaging Het
4933412E24Rik T C 15: 60,016,576 E5G probably benign Het
5730559C18Rik T A 1: 136,225,477 N226Y probably damaging Het
Adam23 T C 1: 63,528,798 V202A noncoding transcript Het
Ahnak A T 19: 9,005,453 D1367V probably damaging Het
Angpt4 A T 2: 151,927,164 Q198L probably benign Het
Apcdd1 T A 18: 62,933,903 H29Q possibly damaging Het
Cdh16 T A 8: 104,615,179 K755* probably null Het
Cdk6 T G 5: 3,390,685 F80V probably benign Het
Chd1 T C 17: 17,387,542 S451P probably benign Het
Chd6 A G 2: 160,957,082 L2361P probably damaging Het
Chst8 A G 7: 34,748,154 M13T possibly damaging Het
Cntnap2 T C 6: 47,095,693 L1065P probably damaging Het
Dctn4 T C 18: 60,526,271 V14A possibly damaging Het
Dicer1 A T 12: 104,691,606 V1903D probably damaging Het
E2f2 A G 4: 136,184,480 silent Het
Eif4g3 T A 4: 138,171,118 S902T possibly damaging Het
Emid1 G T 11: 5,134,353 A152D probably benign Het
Fer1l6 T A 15: 58,560,496 N297K possibly damaging Het
Fes T C 7: 80,383,154 D281G probably null Het
Fry A G 5: 150,445,907 Y2282C probably damaging Het
Gm10377 C T 14: 42,794,707 probably null Het
Gm1527 A G 3: 28,920,600 T521A probably damaging Het
Gm626 T C 14: 33,502,977 V133A probably benign Het
Gpr141 T A 13: 19,751,843 H254L probably benign Het
Gpr160 A G 3: 30,895,947 E56G probably benign Het
Grid2ip T G 5: 143,381,940 probably null Het
Grin2a A G 16: 9,663,518 F473S probably damaging Het
Igkv1-131 T C 6: 67,766,118 T94A probably damaging Het
Iqgap2 A G 13: 95,635,570 L1367P probably damaging Het
Kdm5d T A Y: 936,929 M856K probably damaging Het
Kirrel T C 3: 87,088,002 probably benign Het
Lad1 T C 1: 135,827,762 S259P probably damaging Het
Lalba A T 15: 98,482,111 F86Y possibly damaging Het
Lrfn5 G A 12: 61,839,537 C37Y probably damaging Het
Man2c1 A G 9: 57,139,658 T665A probably benign Het
Myh11 T C 16: 14,224,003 I719V Het
Nbl1 A T 4: 139,085,521 C34S probably damaging Het
Ncapg T A 5: 45,687,388 I575N possibly damaging Het
Nlgn1 T C 3: 25,433,652 T840A possibly damaging Het
Nrd1 T C 4: 109,016,679 S231P possibly damaging Het
Nrg2 T C 18: 36,032,375 K395E probably benign Het
Nrip1 A T 16: 76,292,061 N869K possibly damaging Het
Olfr1259 A G 2: 89,943,372 F248L probably benign Het
Olfr237-ps1 T A 6: 43,153,308 M1K probably null Het
Olfr285 A T 15: 98,312,665 M295K probably benign Het
Otub2 G T 12: 103,402,902 probably null Het
Paxbp1 T C 16: 91,037,415 D161G probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Per2 T A 1: 91,433,448 Q495L possibly damaging Het
Plxna2 T A 1: 194,749,416 V571E probably damaging Het
Prr7 C A 13: 55,472,922 P248T possibly damaging Het
Ptprr A T 10: 116,237,264 T464S possibly damaging Het
Rapgef2 A G 3: 79,086,018 V721A probably benign Het
Rfx1 A T 8: 84,092,850 Y625F probably benign Het
Rps6kb2 G T 19: 4,161,196 A110D possibly damaging Het
Setdb2 A T 14: 59,413,692 probably benign Het
Slc25a31 T C 3: 40,724,920 I272T probably damaging Het
Smpd1 T C 7: 105,555,313 V133A probably benign Het
Sorl1 T C 9: 42,014,481 D1185G probably damaging Het
Spag6 T A 2: 18,745,490 L449H probably benign Het
Sptb C A 12: 76,621,262 R687L probably benign Het
Sptbn5 A T 2: 120,047,135 V1012E noncoding transcript Het
Tmem192 A G 8: 64,964,320 I188V probably benign Het
Tmem253 G A 14: 52,019,251 V194M probably benign Het
Tph1 A G 7: 46,653,749 silent Het
Trak1 A G 9: 121,451,667 E374G probably damaging Het
Trpv1 A T 11: 73,254,767 probably null Het
Trub2 T C 2: 29,777,713 H305R probably benign Het
Ttn A G 2: 76,917,424 V4427A probably benign Het
Vasn A G 16: 4,648,296 T36A probably damaging Het
Vmn1r8 A T 6: 57,036,173 I70F probably benign Het
Vps13c A T 9: 67,954,980 I2960L probably damaging Het
Zdhhc4 C A 5: 143,321,833 M144I probably benign Het
Zfp273 T A 13: 67,825,951 N399K probably benign Het
Zfp976 T A 7: 42,612,701 T572S unknown Het
Zmym4 A G 4: 126,904,567 C756R probably damaging Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
R7908:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R7934:Adamtsl1 UTSW 4 86243725 missense probably damaging 1.00
R8056:Adamtsl1 UTSW 4 86342032 missense possibly damaging 0.76
R8109:Adamtsl1 UTSW 4 86248069 missense
R8143:Adamtsl1 UTSW 4 86342255 missense possibly damaging 0.71
R8205:Adamtsl1 UTSW 4 86199413 makesense probably null
R8215:Adamtsl1 UTSW 4 86343145 missense probably benign 0.45
R8250:Adamtsl1 UTSW 4 86342609 missense probably damaging 1.00
R8417:Adamtsl1 UTSW 4 86156689 missense possibly damaging 0.81
R8494:Adamtsl1 UTSW 4 86321984 missense probably damaging 0.99
R8516:Adamtsl1 UTSW 4 86342543 missense probably damaging 1.00
R8525:Adamtsl1 UTSW 4 86277010 missense probably damaging 1.00
Z1176:Adamtsl1 UTSW 4 86342177 missense probably damaging 0.99
Z1176:Adamtsl1 UTSW 4 86342693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGTGGCCAATGAGCTCATG -3'
(R):5'- AGAGTCCGTCTCCGTTATCC -3'

Sequencing Primer
(F):5'- GCTCATGAACTAAAGTGAAGCTGCC -3'
(R):5'- GGGTTAAATTCCGGAGTTTCCCC -3'
Posted On2020-07-28