Incidental Mutation 'R8261:Sorl1'
ID 639931
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms 2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission
Accession Numbers

Genbank: NM_011436; MGI: 1202296
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R8261 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 41964720-42124297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42014481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1185 (D1185G)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: D1185G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D1185G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,110,343 S75C probably damaging Het
4933412E24Rik T C 15: 60,016,576 E5G probably benign Het
5730559C18Rik T A 1: 136,225,477 N226Y probably damaging Het
Adam23 T C 1: 63,528,798 V202A noncoding transcript Het
Adamtsl1 A C 4: 86,276,883 E512D probably damaging Het
Ahnak A T 19: 9,005,453 D1367V probably damaging Het
Angpt4 A T 2: 151,927,164 Q198L probably benign Het
Apcdd1 T A 18: 62,933,903 H29Q possibly damaging Het
Cdh16 T A 8: 104,615,179 K755* probably null Het
Cdk6 T G 5: 3,390,685 F80V probably benign Het
Chd1 T C 17: 17,387,542 S451P probably benign Het
Chd6 A G 2: 160,957,082 L2361P probably damaging Het
Chst8 A G 7: 34,748,154 M13T possibly damaging Het
Cntnap2 T C 6: 47,095,693 L1065P probably damaging Het
Dctn4 T C 18: 60,526,271 V14A possibly damaging Het
Dicer1 A T 12: 104,691,606 V1903D probably damaging Het
E2f2 A G 4: 136,184,480 silent Het
Eif4g3 T A 4: 138,171,118 S902T possibly damaging Het
Emid1 G T 11: 5,134,353 A152D probably benign Het
Fer1l6 T A 15: 58,560,496 N297K possibly damaging Het
Fes T C 7: 80,383,154 D281G probably null Het
Frmpd2 T C 14: 33,502,977 V133A probably benign Het
Fry A G 5: 150,445,907 Y2282C probably damaging Het
Gm10377 C T 14: 42,794,707 probably null Het
Gm1527 A G 3: 28,920,600 T521A probably damaging Het
Gpr141 T A 13: 19,751,843 H254L probably benign Het
Gpr160 A G 3: 30,895,947 E56G probably benign Het
Grid2ip T G 5: 143,381,940 probably null Het
Grin2a A G 16: 9,663,518 F473S probably damaging Het
Igkv1-131 T C 6: 67,766,118 T94A probably damaging Het
Iqgap2 A G 13: 95,635,570 L1367P probably damaging Het
Kdm5d T A Y: 936,929 M856K probably damaging Het
Kirrel T C 3: 87,088,002 probably benign Het
Lad1 T C 1: 135,827,762 S259P probably damaging Het
Lalba A T 15: 98,482,111 F86Y possibly damaging Het
Lrfn5 G A 12: 61,839,537 C37Y probably damaging Het
Man2c1 A G 9: 57,139,658 T665A probably benign Het
Myh11 T C 16: 14,224,003 I719V Het
Nbl1 A T 4: 139,085,521 C34S probably damaging Het
Ncapg T A 5: 45,687,388 I575N possibly damaging Het
Nlgn1 T C 3: 25,433,652 T840A possibly damaging Het
Nrd1 T C 4: 109,016,679 S231P possibly damaging Het
Nrg2 T C 18: 36,032,375 K395E probably benign Het
Nrip1 A T 16: 76,292,061 N869K possibly damaging Het
Olfr1259 A G 2: 89,943,372 F248L probably benign Het
Olfr237-ps1 T A 6: 43,153,308 M1K probably null Het
Olfr285 A T 15: 98,312,665 M295K probably benign Het
Otub2 G T 12: 103,402,902 probably null Het
Paxbp1 T C 16: 91,037,415 D161G probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Per2 T A 1: 91,433,448 Q495L possibly damaging Het
Plxna2 T A 1: 194,749,416 V571E probably damaging Het
Prr7 C A 13: 55,472,922 P248T possibly damaging Het
Ptprr A T 10: 116,237,264 T464S possibly damaging Het
Rapgef2 A G 3: 79,086,018 V721A probably benign Het
Rfx1 A T 8: 84,092,850 Y625F probably benign Het
Rps6kb2 G T 19: 4,161,196 A110D possibly damaging Het
Setdb2 A T 14: 59,413,692 probably benign Het
Slc25a31 T C 3: 40,724,920 I272T probably damaging Het
Smpd1 T C 7: 105,555,313 V133A probably benign Het
Spag6 T A 2: 18,745,490 L449H probably benign Het
Sptb C A 12: 76,621,262 R687L probably benign Het
Sptbn5 A T 2: 120,047,135 V1012E noncoding transcript Het
Tmem192 A G 8: 64,964,320 I188V probably benign Het
Tmem253 G A 14: 52,019,251 V194M probably benign Het
Tph1 A G 7: 46,653,749 silent Het
Trak1 A G 9: 121,451,667 E374G probably damaging Het
Trpv1 A T 11: 73,254,767 probably null Het
Trub2 T C 2: 29,777,713 H305R probably benign Het
Ttn A G 2: 76,917,424 V4427A probably benign Het
Vasn A G 16: 4,648,296 T36A probably damaging Het
Vmn1r8 A T 6: 57,036,173 I70F probably benign Het
Vps13c A T 9: 67,954,980 I2960L probably damaging Het
Zdhhc4 C A 5: 143,321,833 M144I probably benign Het
Zfp273 T A 13: 67,825,951 N399K probably benign Het
Zfp976 T A 7: 42,612,701 T572S unknown Het
Zmym4 A G 4: 126,904,567 C756R probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
R7763:Sorl1 UTSW 9 42043909 missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42089961 missense probably benign 0.17
R7956:Sorl1 UTSW 9 41989359 missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41991401 missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R8151:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R8219:Sorl1 UTSW 9 42041561 splice site probably null
R8283:Sorl1 UTSW 9 42030998 missense probably damaging 1.00
R8308:Sorl1 UTSW 9 42018160 missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8448:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8524:Sorl1 UTSW 9 41974074 missense probably damaging 1.00
R8869:Sorl1 UTSW 9 42022426 missense probably benign 0.01
R8898:Sorl1 UTSW 9 42000271 missense probably damaging 1.00
R8972:Sorl1 UTSW 9 42046552 missense probably damaging 1.00
R9012:Sorl1 UTSW 9 42071195 missense probably damaging 1.00
R9094:Sorl1 UTSW 9 42063754 missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41974124 nonsense probably null
R9278:Sorl1 UTSW 9 42046561 missense probably benign 0.01
R9288:Sorl1 UTSW 9 42041631 missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41989443 missense probably damaging 1.00
R9330:Sorl1 UTSW 9 42067933 missense probably damaging 1.00
R9332:Sorl1 UTSW 9 42001518 missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42124088 missense probably benign 0.20
R9528:Sorl1 UTSW 9 42022335 critical splice donor site probably null
R9544:Sorl1 UTSW 9 42081809 nonsense probably null
R9563:Sorl1 UTSW 9 42046597 missense probably damaging 1.00
R9564:Sorl1 UTSW 9 42046597 missense probably damaging 1.00
R9588:Sorl1 UTSW 9 42081809 nonsense probably null
R9634:Sorl1 UTSW 9 41996294 missense probably benign
R9671:Sorl1 UTSW 9 42031781 missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42092470 missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42099203 missense possibly damaging 0.64
Z1176:Sorl1 UTSW 9 42123948 missense probably benign 0.03
Z1177:Sorl1 UTSW 9 41991638 missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42106541 missense probably benign 0.00
Z1177:Sorl1 UTSW 9 42123912 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTATGATCATAGCTCCCACCTC -3'
(R):5'- CTGAACAATTGGTGGCATGTG -3'

Sequencing Primer
(F):5'- TCATTACACACAAGCTCCGAGG -3'
(R):5'- TGACTTCTTAGATGTCTAACCTTGG -3'
Posted On 2020-07-28