Mutagenetix > Incidental Mutations

Incidental Mutation 'R8261:Dicer1'

639941

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104691606 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1903 (V1903D)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: V1903D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: V1903D

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Meta Mutation Damage Score

0.2879

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (76/76)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,110,343	S75C	probably damaging	Het
4933412E24Rik	T	C	15: 60,016,576	E5G	probably benign	Het
5730559C18Rik	T	A	1: 136,225,477	N226Y	probably damaging	Het
Adam23	T	C	1: 63,528,798	V202A	noncoding transcript	Het
Adamtsl1	A	C	4: 86,276,883	E512D	probably damaging	Het
Ahnak	A	T	19: 9,005,453	D1367V	probably damaging	Het
Angpt4	A	T	2: 151,927,164	Q198L	probably benign	Het
Apcdd1	T	A	18: 62,933,903	H29Q	possibly damaging	Het
Cdh16	T	A	8: 104,615,179	K755*	probably null	Het
Cdk6	T	G	5: 3,390,685	F80V	probably benign	Het
Chd1	T	C	17: 17,387,542	S451P	probably benign	Het
Chd6	A	G	2: 160,957,082	L2361P	probably damaging	Het
Chst8	A	G	7: 34,748,154	M13T	possibly damaging	Het
Cntnap2	T	C	6: 47,095,693	L1065P	probably damaging	Het
Dctn4	T	C	18: 60,526,271	V14A	possibly damaging	Het
E2f2	A	G	4: 136,184,480		silent	Het
Eif4g3	T	A	4: 138,171,118	S902T	possibly damaging	Het
Emid1	G	T	11: 5,134,353	A152D	probably benign	Het
Fer1l6	T	A	15: 58,560,496	N297K	possibly damaging	Het
Fes	T	C	7: 80,383,154	D281G	probably null	Het
Fry	A	G	5: 150,445,907	Y2282C	probably damaging	Het
Gm10377	C	T	14: 42,794,707		probably null	Het
Gm1527	A	G	3: 28,920,600	T521A	probably damaging	Het
Gm626	T	C	14: 33,502,977	V133A	probably benign	Het
Gpr141	T	A	13: 19,751,843	H254L	probably benign	Het
Gpr160	A	G	3: 30,895,947	E56G	probably benign	Het
Grid2ip	T	G	5: 143,381,940		probably null	Het
Grin2a	A	G	16: 9,663,518	F473S	probably damaging	Het
Igkv1-131	T	C	6: 67,766,118	T94A	probably damaging	Het
Iqgap2	A	G	13: 95,635,570	L1367P	probably damaging	Het
Kdm5d	T	A	Y: 936,929	M856K	probably damaging	Het
Kirrel	T	C	3: 87,088,002		probably benign	Het
Lad1	T	C	1: 135,827,762	S259P	probably damaging	Het
Lalba	A	T	15: 98,482,111	F86Y	possibly damaging	Het
Lrfn5	G	A	12: 61,839,537	C37Y	probably damaging	Het
Man2c1	A	G	9: 57,139,658	T665A	probably benign	Het
Myh11	T	C	16: 14,224,003	I719V		Het
Nbl1	A	T	4: 139,085,521	C34S	probably damaging	Het
Ncapg	T	A	5: 45,687,388	I575N	possibly damaging	Het
Nlgn1	T	C	3: 25,433,652	T840A	possibly damaging	Het
Nrd1	T	C	4: 109,016,679	S231P	possibly damaging	Het
Nrg2	T	C	18: 36,032,375	K395E	probably benign	Het
Nrip1	A	T	16: 76,292,061	N869K	possibly damaging	Het
Olfr1259	A	G	2: 89,943,372	F248L	probably benign	Het
Olfr237-ps1	T	A	6: 43,153,308	M1K	probably null	Het
Olfr285	A	T	15: 98,312,665	M295K	probably benign	Het
Otub2	G	T	12: 103,402,902		probably null	Het
Paxbp1	T	C	16: 91,037,415	D161G	probably benign	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Per2	T	A	1: 91,433,448	Q495L	possibly damaging	Het
Plxna2	T	A	1: 194,749,416	V571E	probably damaging	Het
Prr7	C	A	13: 55,472,922	P248T	possibly damaging	Het
Ptprr	A	T	10: 116,237,264	T464S	possibly damaging	Het
Rapgef2	A	G	3: 79,086,018	V721A	probably benign	Het
Rfx1	A	T	8: 84,092,850	Y625F	probably benign	Het
Rps6kb2	G	T	19: 4,161,196	A110D	possibly damaging	Het
Setdb2	A	T	14: 59,413,692		probably benign	Het
Slc25a31	T	C	3: 40,724,920	I272T	probably damaging	Het
Smpd1	T	C	7: 105,555,313	V133A	probably benign	Het
Sorl1	T	C	9: 42,014,481	D1185G	probably damaging	Het
Spag6	T	A	2: 18,745,490	L449H	probably benign	Het
Sptb	C	A	12: 76,621,262	R687L	probably benign	Het
Sptbn5	A	T	2: 120,047,135	V1012E	noncoding transcript	Het
Tmem192	A	G	8: 64,964,320	I188V	probably benign	Het
Tmem253	G	A	14: 52,019,251	V194M	probably benign	Het
Tph1	A	G	7: 46,653,749		silent	Het
Trak1	A	G	9: 121,451,667	E374G	probably damaging	Het
Trpv1	A	T	11: 73,254,767		probably null	Het
Trub2	T	C	2: 29,777,713	H305R	probably benign	Het
Ttn	A	G	2: 76,917,424	V4427A	probably benign	Het
Vasn	A	G	16: 4,648,296	T36A	probably damaging	Het
Vmn1r8	A	T	6: 57,036,173	I70F	probably benign	Het
Vps13c	A	T	9: 67,954,980	I2960L	probably damaging	Het
Zdhhc4	C	A	5: 143,321,833	M144I	probably benign	Het
Zfp273	T	A	13: 67,825,951	N399K	probably benign	Het
Zfp976	T	A	7: 42,612,701	T572S	unknown	Het
Zmym4	A	G	4: 126,904,567	C756R	probably damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- CCTGTGACTAAGCAAAGCAGG -3'
(R):5'- CAAACTGTCTGGGGTTTTGC -3'

Sequencing Primer
(F):5'- CAAGATTGTGTCTGCGCAAAAAC -3'
(R):5'- TTTTGCAGCCCAGCGGAG -3'

Posted On

2020-07-28