Incidental Mutation 'R8261:4933412E24Rik'
ID639950
Institutional Source Beutler Lab
Gene Symbol 4933412E24Rik
Ensembl Gene ENSMUSG00000071749
Gene NameRIKEN cDNA 4933412E24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8261 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location60014866-60016613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60016576 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 5 (E5G)
Ref Sequence ENSEMBL: ENSMUSP00000094154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096421]
Predicted Effect probably benign
Transcript: ENSMUST00000096421
AA Change: E5G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094154
Gene: ENSMUSG00000071749
AA Change: E5G

DomainStartEndE-ValueType
Pfam:DUF4641 79 509 5.4e-189 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,110,343 S75C probably damaging Het
5730559C18Rik T A 1: 136,225,477 N226Y probably damaging Het
Adam23 T C 1: 63,528,798 V202A noncoding transcript Het
Adamtsl1 A C 4: 86,276,883 E512D probably damaging Het
Ahnak A T 19: 9,005,453 D1367V probably damaging Het
Angpt4 A T 2: 151,927,164 Q198L probably benign Het
Apcdd1 T A 18: 62,933,903 H29Q possibly damaging Het
Cdh16 T A 8: 104,615,179 K755* probably null Het
Cdk6 T G 5: 3,390,685 F80V probably benign Het
Chd1 T C 17: 17,387,542 S451P probably benign Het
Chd6 A G 2: 160,957,082 L2361P probably damaging Het
Chst8 A G 7: 34,748,154 M13T possibly damaging Het
Cntnap2 T C 6: 47,095,693 L1065P probably damaging Het
Dctn4 T C 18: 60,526,271 V14A possibly damaging Het
Dicer1 A T 12: 104,691,606 V1903D probably damaging Het
Eif4g3 T A 4: 138,171,118 S902T possibly damaging Het
Emid1 G T 11: 5,134,353 A152D probably benign Het
Fer1l6 T A 15: 58,560,496 N297K possibly damaging Het
Fes T C 7: 80,383,154 D281G probably null Het
Fry A G 5: 150,445,907 Y2282C probably damaging Het
Gm10377 C T 14: 42,794,707 probably null Het
Gm1527 A G 3: 28,920,600 T521A probably damaging Het
Gm626 T C 14: 33,502,977 V133A probably benign Het
Gpr141 T A 13: 19,751,843 H254L probably benign Het
Gpr160 A G 3: 30,895,947 E56G probably benign Het
Grid2ip T G 5: 143,381,940 probably null Het
Grin2a A G 16: 9,663,518 F473S probably damaging Het
Igkv1-131 T C 6: 67,766,118 T94A probably damaging Het
Iqgap2 A G 13: 95,635,570 L1367P probably damaging Het
Kdm5d T A Y: 936,929 M856K probably damaging Het
Lad1 T C 1: 135,827,762 S259P probably damaging Het
Lalba A T 15: 98,482,111 F86Y possibly damaging Het
Lrfn5 G A 12: 61,839,537 C37Y probably damaging Het
Man2c1 A G 9: 57,139,658 T665A probably benign Het
Myh11 T C 16: 14,224,003 I719V Het
Nbl1 A T 4: 139,085,521 C34S probably damaging Het
Ncapg T A 5: 45,687,388 I575N possibly damaging Het
Nlgn1 T C 3: 25,433,652 T840A possibly damaging Het
Nrd1 T C 4: 109,016,679 S231P possibly damaging Het
Nrg2 T C 18: 36,032,375 K395E probably benign Het
Nrip1 A T 16: 76,292,061 N869K possibly damaging Het
Olfr1259 A G 2: 89,943,372 F248L probably benign Het
Olfr237-ps1 T A 6: 43,153,308 M1K probably null Het
Olfr285 A T 15: 98,312,665 M295K probably benign Het
Otub2 G T 12: 103,402,902 probably null Het
Paxbp1 T C 16: 91,037,415 D161G probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Per2 T A 1: 91,433,448 Q495L possibly damaging Het
Plxna2 T A 1: 194,749,416 V571E probably damaging Het
Prr7 C A 13: 55,472,922 P248T possibly damaging Het
Ptprr A T 10: 116,237,264 T464S possibly damaging Het
Rapgef2 A G 3: 79,086,018 V721A probably benign Het
Rfx1 A T 8: 84,092,850 Y625F probably benign Het
Rps6kb2 G T 19: 4,161,196 A110D possibly damaging Het
Slc25a31 T C 3: 40,724,920 I272T probably damaging Het
Smpd1 T C 7: 105,555,313 V133A probably benign Het
Sorl1 T C 9: 42,014,481 D1185G probably damaging Het
Spag6 T A 2: 18,745,490 L449H probably benign Het
Sptb C A 12: 76,621,262 R687L probably benign Het
Sptbn5 A T 2: 120,047,135 V1012E noncoding transcript Het
Tmem192 A G 8: 64,964,320 I188V probably benign Het
Tmem253 G A 14: 52,019,251 V194M probably benign Het
Trak1 A G 9: 121,451,667 E374G probably damaging Het
Trpv1 A T 11: 73,254,767 probably null Het
Trub2 T C 2: 29,777,713 H305R probably benign Het
Ttn A G 2: 76,917,424 V4427A probably benign Het
Vasn A G 16: 4,648,296 T36A probably damaging Het
Vmn1r8 A T 6: 57,036,173 I70F probably benign Het
Vps13c A T 9: 67,954,980 I2960L probably damaging Het
Zdhhc4 C A 5: 143,321,833 M144I probably benign Het
Zfp273 T A 13: 67,825,951 N399K probably benign Het
Zfp976 T A 7: 42,612,701 T572S unknown Het
Zmym4 A G 4: 126,904,567 C756R probably damaging Het
Other mutations in 4933412E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:4933412E24Rik APN 15 60015575 missense possibly damaging 0.82
IGL02078:4933412E24Rik APN 15 60016330 missense probably benign 0.02
IGL02493:4933412E24Rik APN 15 60016463 missense probably benign 0.00
IGL03336:4933412E24Rik APN 15 60016402 missense probably benign 0.00
R0466:4933412E24Rik UTSW 15 60015472 missense probably benign 0.00
R0961:4933412E24Rik UTSW 15 60015311 missense probably benign 0.36
R1765:4933412E24Rik UTSW 15 60015345 nonsense probably null
R2341:4933412E24Rik UTSW 15 60016363 missense possibly damaging 0.85
R2440:4933412E24Rik UTSW 15 60016280 missense probably benign
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R4039:4933412E24Rik UTSW 15 60016366 missense possibly damaging 0.95
R4416:4933412E24Rik UTSW 15 60016423 missense possibly damaging 0.88
R4868:4933412E24Rik UTSW 15 60015968 missense possibly damaging 0.50
R4907:4933412E24Rik UTSW 15 60016108 missense probably benign 0.00
R5462:4933412E24Rik UTSW 15 60015068 missense probably benign 0.09
R7275:4933412E24Rik UTSW 15 60015889 missense probably benign 0.32
R7842:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
R8297:4933412E24Rik UTSW 15 60015675 missense probably damaging 1.00
R8378:4933412E24Rik UTSW 15 60015118 missense probably damaging 0.99
X0052:4933412E24Rik UTSW 15 60016526 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGGGTTCTCTGACGCTTC -3'
(R):5'- AAAGGACTACTGAAGATGTCTCTC -3'

Sequencing Primer
(F):5'- TCTGACGCTTCCAGCTGG -3'
(R):5'- GGGAAAAAGCCATAAATCCTGTTC -3'
Posted On2020-07-28