Incidental Mutation 'R8260:Dpp10'
ID639968
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Namedipeptidylpeptidase 10
Synonyms6430601K09Rik, DPRP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8260 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location123321471-124045559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123686295 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 102 (T102S)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
Predicted Effect probably benign
Transcript: ENSMUST00000112603
AA Change: T91S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: T91S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112606
AA Change: T102S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: T102S

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 63,986,184 L48V probably benign Het
Acbd3 T C 1: 180,738,530 Y263H probably damaging Het
Acot4 C A 12: 84,042,035 P219Q possibly damaging Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Arid1b A G 17: 5,332,513 T1292A probably benign Het
Arntl A T 7: 113,285,051 I92F probably damaging Het
Atp2c1 T A 9: 105,418,579 I649F probably damaging Het
Bbs10 C T 10: 111,300,243 Q406* probably null Het
Bcas3 T A 11: 85,509,546 M447K possibly damaging Het
Cars T C 7: 143,585,709 D214G probably benign Het
Ccdc88a A T 11: 29,493,934 I1410F probably benign Het
Cd55b A T 1: 130,388,678 L378H probably damaging Het
Cdh1 G A 8: 106,604,347 E37K probably benign Het
Cep72 T C 13: 74,058,346 Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,733 T176A possibly damaging Het
D630045J12Rik T A 6: 38,142,911 probably null Het
Ddi1 A T 9: 6,265,524 C282S probably damaging Het
Ddit4 T C 10: 59,951,455 T20A probably benign Het
Ep400 T A 5: 110,755,612 K374* probably null Het
Epha3 A G 16: 63,583,554 L728P probably damaging Het
Fbxw21 C A 9: 109,146,546 probably null Het
Frmpd1 A G 4: 45,244,638 E109G probably damaging Het
Ggt1 C T 10: 75,581,411 P332L probably damaging Het
Gm10081 A T 7: 107,106,855 M2K probably benign Het
Gm4737 T C 16: 46,154,423 E197G probably damaging Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Gm5431 A T 11: 48,894,729 I273K probably benign Het
Gm7697 A T 8: 69,519,748 D116E possibly damaging Het
Gon4l A G 3: 88,892,630 N861D probably damaging Het
Grm5 T C 7: 88,075,132 probably null Het
Helt T C 8: 46,292,708 N84S possibly damaging Het
Hnrnpa0 G T 13: 58,127,414 Y300* probably null Het
Ints1 T C 5: 139,765,213 T810A Het
Irf2bp1 C T 7: 19,006,154 A573V possibly damaging Het
Itgbl1 C A 14: 123,827,834 D133E probably benign Het
Kctd15 A G 7: 34,644,842 F128S possibly damaging Het
Klra17 T A 6: 129,831,458 N271Y probably damaging Het
Kmt2c T A 5: 25,405,516 E197D possibly damaging Het
Larp1 C A 11: 58,058,689 T1048K probably benign Het
Macf1 A G 4: 123,472,070 V2966A probably benign Het
Magi3 A G 3: 104,015,309 L1364P probably benign Het
Malrd1 T C 2: 15,614,206 S294P Het
Med13l C T 5: 118,748,729 T1565I possibly damaging Het
Mov10l1 A G 15: 89,012,110 D719G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh14 T C 7: 44,615,376 E1654G probably damaging Het
Myo1c C T 11: 75,656,116 probably benign Het
Myo9a A G 9: 59,910,678 T2343A probably benign Het
Olfr1012 A T 2: 85,759,476 L300Q probably damaging Het
Olfr1055 T A 2: 86,346,932 Y278F possibly damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr553 T A 7: 102,614,225 I255F possibly damaging Het
Olfr669 T A 7: 104,938,672 Y49N probably damaging Het
Olfr700 A T 7: 106,806,027 V145E possibly damaging Het
Olfr734 T C 14: 50,320,158 K226E probably benign Het
Olfr791 T A 10: 129,527,088 I287N possibly damaging Het
Osmr A T 15: 6,815,416 D957E probably benign Het
Pappa T A 4: 65,316,182 V1408E probably damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pdcd6ip A T 9: 113,672,797 D464E probably benign Het
Pde1c T C 6: 56,137,419 Y503C probably benign Het
Prob1 T A 18: 35,654,157 E348V possibly damaging Het
Rnls A G 19: 33,202,648 L134S probably damaging Het
Scrn3 T C 2: 73,335,858 Y412H probably damaging Het
Serpina3g T C 12: 104,239,103 S34P probably benign Het
Sertad3 G A 7: 27,476,359 A73T probably benign Het
Sez6l C T 5: 112,461,256 A576T probably benign Het
Sh3tc2 G A 18: 62,013,066 R1172H probably damaging Het
Sirt3 A G 7: 140,876,406 V110A Het
Smpd3 A T 8: 106,257,415 D557E probably benign Het
Soga3 T A 10: 29,148,274 H395Q possibly damaging Het
Sptssb A T 3: 69,820,972 M44K probably damaging Het
Tars2 A G 3: 95,754,820 W7R probably damaging Het
Tbc1d9b A G 11: 50,164,186 D964G probably benign Het
Tiam2 A T 17: 3,518,319 D1580V possibly damaging Het
Tmeff2 T A 1: 50,938,319 V130D probably damaging Het
Top2a T A 11: 99,000,769 E1176V probably null Het
Trappc9 C A 15: 72,941,909 E680* probably null Het
Trip10 A G 17: 57,257,314 N355S probably benign Het
Ttn T C 2: 76,765,993 E20192G probably damaging Het
Vmn2r96 A G 17: 18,583,981 M306V probably benign Het
Wdr90 A T 17: 25,845,167 H1860Q probably damaging Het
Wrnip1 A G 13: 32,805,356 I276V possibly damaging Het
Zfp608 T C 18: 54,897,749 K1040E possibly damaging Het
Zfp808 T A 13: 62,172,738 C594S probably benign Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTAAAGGTACTAGAGCAGTGTTAC -3'
(R):5'- CTCAGTAACCCTATGTTCAATGCAC -3'

Sequencing Primer
(F):5'- GCAGTGTTACAGATACTAAGTACCAC -3'
(R):5'- GAAGCATGTGTTAGGCAAATTTCCTG -3'
Posted On2020-07-28