Incidental Mutation 'R8260:Pappa'
ID639982
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R8260 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65316182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1408 (V1408E)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: V1408E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: V1408E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 63,986,184 L48V probably benign Het
Acbd3 T C 1: 180,738,530 Y263H probably damaging Het
Acot4 C A 12: 84,042,035 P219Q possibly damaging Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Arid1b A G 17: 5,332,513 T1292A probably benign Het
Arntl A T 7: 113,285,051 I92F probably damaging Het
Atp2c1 T A 9: 105,418,579 I649F probably damaging Het
Bbs10 C T 10: 111,300,243 Q406* probably null Het
Bcas3 T A 11: 85,509,546 M447K possibly damaging Het
Cars T C 7: 143,585,709 D214G probably benign Het
Ccdc88a A T 11: 29,493,934 I1410F probably benign Het
Cd55b A T 1: 130,388,678 L378H probably damaging Het
Cdh1 G A 8: 106,604,347 E37K probably benign Het
Cep72 T C 13: 74,058,346 Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,733 T176A possibly damaging Het
D630045J12Rik T A 6: 38,142,911 probably null Het
Ddi1 A T 9: 6,265,524 C282S probably damaging Het
Ddit4 T C 10: 59,951,455 T20A probably benign Het
Dpp10 T A 1: 123,686,295 T102S probably benign Het
Ep400 T A 5: 110,755,612 K374* probably null Het
Epha3 A G 16: 63,583,554 L728P probably damaging Het
Fbxw21 C A 9: 109,146,546 probably null Het
Frmpd1 A G 4: 45,244,638 E109G probably damaging Het
Ggt1 C T 10: 75,581,411 P332L probably damaging Het
Gm10081 A T 7: 107,106,855 M2K probably benign Het
Gm4737 T C 16: 46,154,423 E197G probably damaging Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Gm5431 A T 11: 48,894,729 I273K probably benign Het
Gm7697 A T 8: 69,519,748 D116E possibly damaging Het
Gon4l A G 3: 88,892,630 N861D probably damaging Het
Grm5 T C 7: 88,075,132 probably null Het
Helt T C 8: 46,292,708 N84S possibly damaging Het
Hnrnpa0 G T 13: 58,127,414 Y300* probably null Het
Ints1 T C 5: 139,765,213 T810A Het
Irf2bp1 C T 7: 19,006,154 A573V possibly damaging Het
Itgbl1 C A 14: 123,827,834 D133E probably benign Het
Kctd15 A G 7: 34,644,842 F128S possibly damaging Het
Klra17 T A 6: 129,831,458 N271Y probably damaging Het
Kmt2c T A 5: 25,405,516 E197D possibly damaging Het
Larp1 C A 11: 58,058,689 T1048K probably benign Het
Macf1 A G 4: 123,472,070 V2966A probably benign Het
Magi3 A G 3: 104,015,309 L1364P probably benign Het
Malrd1 T C 2: 15,614,206 S294P Het
Med13l C T 5: 118,748,729 T1565I possibly damaging Het
Mov10l1 A G 15: 89,012,110 D719G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh14 T C 7: 44,615,376 E1654G probably damaging Het
Myo1c C T 11: 75,656,116 probably benign Het
Myo9a A G 9: 59,910,678 T2343A probably benign Het
Olfr1012 A T 2: 85,759,476 L300Q probably damaging Het
Olfr1055 T A 2: 86,346,932 Y278F possibly damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr553 T A 7: 102,614,225 I255F possibly damaging Het
Olfr669 T A 7: 104,938,672 Y49N probably damaging Het
Olfr700 A T 7: 106,806,027 V145E possibly damaging Het
Olfr734 T C 14: 50,320,158 K226E probably benign Het
Olfr791 T A 10: 129,527,088 I287N possibly damaging Het
Osmr A T 15: 6,815,416 D957E probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pdcd6ip A T 9: 113,672,797 D464E probably benign Het
Pde1c T C 6: 56,137,419 Y503C probably benign Het
Prob1 T A 18: 35,654,157 E348V possibly damaging Het
Rnls A G 19: 33,202,648 L134S probably damaging Het
Scrn3 T C 2: 73,335,858 Y412H probably damaging Het
Serpina3g T C 12: 104,239,103 S34P probably benign Het
Sertad3 G A 7: 27,476,359 A73T probably benign Het
Sez6l C T 5: 112,461,256 A576T probably benign Het
Sh3tc2 G A 18: 62,013,066 R1172H probably damaging Het
Sirt3 A G 7: 140,876,406 V110A Het
Smpd3 A T 8: 106,257,415 D557E probably benign Het
Soga3 T A 10: 29,148,274 H395Q possibly damaging Het
Sptssb A T 3: 69,820,972 M44K probably damaging Het
Tars2 A G 3: 95,754,820 W7R probably damaging Het
Tbc1d9b A G 11: 50,164,186 D964G probably benign Het
Tiam2 A T 17: 3,518,319 D1580V possibly damaging Het
Tmeff2 T A 1: 50,938,319 V130D probably damaging Het
Top2a T A 11: 99,000,769 E1176V probably null Het
Trappc9 C A 15: 72,941,909 E680* probably null Het
Trip10 A G 17: 57,257,314 N355S probably benign Het
Ttn T C 2: 76,765,993 E20192G probably damaging Het
Vmn2r96 A G 17: 18,583,981 M306V probably benign Het
Wdr90 A T 17: 25,845,167 H1860Q probably damaging Het
Wrnip1 A G 13: 32,805,356 I276V possibly damaging Het
Zfp608 T C 18: 54,897,749 K1040E possibly damaging Het
Zfp808 T A 13: 62,172,738 C594S probably benign Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
mama UTSW 4 65204867 missense possibly damaging 0.94
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
R7410:Pappa UTSW 4 65335719 missense probably damaging 1.00
R7457:Pappa UTSW 4 65189266 missense probably damaging 1.00
R7506:Pappa UTSW 4 65231182 missense probably benign 0.00
R7546:Pappa UTSW 4 65156115 missense possibly damaging 0.48
R7975:Pappa UTSW 4 65294468 missense probably damaging 0.96
R8111:Pappa UTSW 4 65261992 missense probably damaging 0.99
R8347:Pappa UTSW 4 65327065 missense probably damaging 1.00
RF006:Pappa UTSW 4 65323873 missense probably benign 0.00
RF020:Pappa UTSW 4 65205045 missense possibly damaging 0.77
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Z1177:Pappa UTSW 4 65307758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATCCCTCATACAGCCAG -3'
(R):5'- AGCTTCTGCAATGGTGATATTGTC -3'

Sequencing Primer
(F):5'- TCCCTCATACAGCCAGCAGATTATG -3'
(R):5'- CCCCCTAAGATAGCAGCTGTTTAAG -3'
Posted On2020-07-28