Incidental Mutation 'R8260:Fbxw21'
ID640012
Institutional Source Beutler Lab
Gene Symbol Fbxw21
Ensembl Gene ENSMUSG00000047237
Gene NameF-box and WD-40 domain protein 21
SynonymsE330009P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8260 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109139447-109162041 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 109146546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054925] [ENSMUST00000054925] [ENSMUST00000054925] [ENSMUST00000054925] [ENSMUST00000198076] [ENSMUST00000199540]
Predicted Effect probably null
Transcript: ENSMUST00000054925
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000054925
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000054925
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000054925
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198076
SMART Domains Protein: ENSMUSP00000143095
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 9e-8 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199540
SMART Domains Protein: ENSMUSP00000143200
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 9e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 63,986,184 L48V probably benign Het
Acbd3 T C 1: 180,738,530 Y263H probably damaging Het
Acot4 C A 12: 84,042,035 P219Q possibly damaging Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Arid1b A G 17: 5,332,513 T1292A probably benign Het
Arntl A T 7: 113,285,051 I92F probably damaging Het
Atp2c1 T A 9: 105,418,579 I649F probably damaging Het
Bbs10 C T 10: 111,300,243 Q406* probably null Het
Bcas3 T A 11: 85,509,546 M447K possibly damaging Het
Cars T C 7: 143,585,709 D214G probably benign Het
Ccdc88a A T 11: 29,493,934 I1410F probably benign Het
Cd55b A T 1: 130,388,678 L378H probably damaging Het
Cdh1 G A 8: 106,604,347 E37K probably benign Het
Cep72 T C 13: 74,058,346 Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,733 T176A possibly damaging Het
D630045J12Rik T A 6: 38,142,911 probably null Het
Ddi1 A T 9: 6,265,524 C282S probably damaging Het
Ddit4 T C 10: 59,951,455 T20A probably benign Het
Dpp10 T A 1: 123,686,295 T102S probably benign Het
Ep400 T A 5: 110,755,612 K374* probably null Het
Epha3 A G 16: 63,583,554 L728P probably damaging Het
Frmpd1 A G 4: 45,244,638 E109G probably damaging Het
Ggt1 C T 10: 75,581,411 P332L probably damaging Het
Gm10081 A T 7: 107,106,855 M2K probably benign Het
Gm4737 T C 16: 46,154,423 E197G probably damaging Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Gm5431 A T 11: 48,894,729 I273K probably benign Het
Gm7697 A T 8: 69,519,748 D116E possibly damaging Het
Gon4l A G 3: 88,892,630 N861D probably damaging Het
Grm5 T C 7: 88,075,132 probably null Het
Helt T C 8: 46,292,708 N84S possibly damaging Het
Hnrnpa0 G T 13: 58,127,414 Y300* probably null Het
Ints1 T C 5: 139,765,213 T810A Het
Irf2bp1 C T 7: 19,006,154 A573V possibly damaging Het
Itgbl1 C A 14: 123,827,834 D133E probably benign Het
Kctd15 A G 7: 34,644,842 F128S possibly damaging Het
Klra17 T A 6: 129,831,458 N271Y probably damaging Het
Kmt2c T A 5: 25,405,516 E197D possibly damaging Het
Larp1 C A 11: 58,058,689 T1048K probably benign Het
Macf1 A G 4: 123,472,070 V2966A probably benign Het
Magi3 A G 3: 104,015,309 L1364P probably benign Het
Malrd1 T C 2: 15,614,206 S294P Het
Med13l C T 5: 118,748,729 T1565I possibly damaging Het
Mov10l1 A G 15: 89,012,110 D719G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh14 T C 7: 44,615,376 E1654G probably damaging Het
Myo1c C T 11: 75,656,116 probably benign Het
Myo9a A G 9: 59,910,678 T2343A probably benign Het
Olfr1012 A T 2: 85,759,476 L300Q probably damaging Het
Olfr1055 T A 2: 86,346,932 Y278F possibly damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr553 T A 7: 102,614,225 I255F possibly damaging Het
Olfr669 T A 7: 104,938,672 Y49N probably damaging Het
Olfr700 A T 7: 106,806,027 V145E possibly damaging Het
Olfr734 T C 14: 50,320,158 K226E probably benign Het
Olfr791 T A 10: 129,527,088 I287N possibly damaging Het
Osmr A T 15: 6,815,416 D957E probably benign Het
Pappa T A 4: 65,316,182 V1408E probably damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pdcd6ip A T 9: 113,672,797 D464E probably benign Het
Pde1c T C 6: 56,137,419 Y503C probably benign Het
Prob1 T A 18: 35,654,157 E348V possibly damaging Het
Rnls A G 19: 33,202,648 L134S probably damaging Het
Scrn3 T C 2: 73,335,858 Y412H probably damaging Het
Serpina3g T C 12: 104,239,103 S34P probably benign Het
Sertad3 G A 7: 27,476,359 A73T probably benign Het
Sez6l C T 5: 112,461,256 A576T probably benign Het
Sh3tc2 G A 18: 62,013,066 R1172H probably damaging Het
Sirt3 A G 7: 140,876,406 V110A Het
Smpd3 A T 8: 106,257,415 D557E probably benign Het
Soga3 T A 10: 29,148,274 H395Q possibly damaging Het
Sptssb A T 3: 69,820,972 M44K probably damaging Het
Tars2 A G 3: 95,754,820 W7R probably damaging Het
Tbc1d9b A G 11: 50,164,186 D964G probably benign Het
Tiam2 A T 17: 3,518,319 D1580V possibly damaging Het
Tmeff2 T A 1: 50,938,319 V130D probably damaging Het
Top2a T A 11: 99,000,769 E1176V probably null Het
Trappc9 C A 15: 72,941,909 E680* probably null Het
Trip10 A G 17: 57,257,314 N355S probably benign Het
Ttn T C 2: 76,765,993 E20192G probably damaging Het
Vmn2r96 A G 17: 18,583,981 M306V probably benign Het
Wdr90 A T 17: 25,845,167 H1860Q probably damaging Het
Wrnip1 A G 13: 32,805,356 I276V possibly damaging Het
Zfp608 T C 18: 54,897,749 K1040E possibly damaging Het
Zfp808 T A 13: 62,172,738 C594S probably benign Het
Other mutations in Fbxw21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Fbxw21 APN 9 109161964 missense probably damaging 1.00
IGL00901:Fbxw21 APN 9 109156399 missense probably benign 0.00
IGL01377:Fbxw21 APN 9 109146645 nonsense probably null
IGL01941:Fbxw21 APN 9 109148156 missense probably benign 0.07
IGL02491:Fbxw21 APN 9 109143819 missense probably benign
IGL03163:Fbxw21 APN 9 109145484 missense probably benign 0.01
IGL03377:Fbxw21 APN 9 109139529 missense probably benign 0.01
R0148:Fbxw21 UTSW 9 109148017 critical splice donor site probably null
R0328:Fbxw21 UTSW 9 109146585 missense possibly damaging 0.52
R0909:Fbxw21 UTSW 9 109156408 missense possibly damaging 0.84
R1506:Fbxw21 UTSW 9 109148189 missense probably damaging 1.00
R1575:Fbxw21 UTSW 9 109161916 missense probably benign 0.00
R1615:Fbxw21 UTSW 9 109143726 missense probably damaging 1.00
R1719:Fbxw21 UTSW 9 109148174 missense possibly damaging 0.85
R2415:Fbxw21 UTSW 9 109156401 missense possibly damaging 0.71
R2424:Fbxw21 UTSW 9 109157519 nonsense probably null
R2508:Fbxw21 UTSW 9 109145485 missense probably benign 0.31
R2898:Fbxw21 UTSW 9 109156336 missense possibly damaging 0.52
R2964:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2965:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2966:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R4809:Fbxw21 UTSW 9 109143390 missense probably damaging 1.00
R4911:Fbxw21 UTSW 9 109145663 missense probably damaging 1.00
R5669:Fbxw21 UTSW 9 109145510 missense probably benign 0.12
R5928:Fbxw21 UTSW 9 109143825 missense possibly damaging 0.55
R6043:Fbxw21 UTSW 9 109145539 missense possibly damaging 0.69
R6277:Fbxw21 UTSW 9 109145555 missense possibly damaging 0.95
R6805:Fbxw21 UTSW 9 109157565 missense probably damaging 1.00
R6944:Fbxw21 UTSW 9 109157535 missense probably damaging 1.00
R7079:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R7081:Fbxw21 UTSW 9 109161922 missense probably damaging 1.00
R7744:Fbxw21 UTSW 9 109157652 missense possibly damaging 0.81
R7774:Fbxw21 UTSW 9 109143840 missense probably benign 0.00
R7980:Fbxw21 UTSW 9 109156571 splice site probably null
R8043:Fbxw21 UTSW 9 109146626 missense probably benign 0.01
Z1088:Fbxw21 UTSW 9 109145537 missense probably benign
Z1176:Fbxw21 UTSW 9 109145537 missense probably benign
Z1177:Fbxw21 UTSW 9 109145537 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAGCCACATTTCAAGGATAC -3'
(R):5'- TTTCTCCACTGACCAGGTGC -3'

Sequencing Primer
(F):5'- ATAGATATTTGCCATTGTGACTGGTC -3'
(R):5'- ACTGACCAGGTGCTGCTG -3'
Posted On2020-07-28