Mutagenetix > Incidental Mutation

Incidental Mutation 'R0094:Ptpro'

64003

Institutional Source

Beutler Lab

Gene Symbol

Ptpro

Ensembl Gene

ENSMUSG00000030223

Gene Name

protein tyrosine phosphatase, receptor type, O

Synonyms

Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt

MMRRC Submission

038380-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0094 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

137252319-137463233 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 137386352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 495 (Y495H)

Ref Sequence

ENSEMBL: ENSMUSP00000127112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]

AlphaFold

E9Q612

Predicted Effect

probably benign
Transcript: ENSMUST00000077115
AA Change: Y495H

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: Y495H

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
transmembrane domain	890	912	N/A	INTRINSIC
PTPc	947	1207	1.43e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167679
AA Change: Y495H

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: Y495H

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
PTPc	919	1179	1.43e-127	SMART

Meta Mutation Damage Score

0.1968

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,306,886	T185S	possibly damaging	Het
Amotl1	A	G	9: 14,575,387	S441P	probably benign	Het
Ap5z1	G	A	5: 142,476,812	V626M	probably benign	Het
Cacna2d3	C	T	14: 29,170,503		probably null	Het
Cfap77	A	T	2: 28,984,434	V128D	probably damaging	Het
Colgalt1	T	C	8: 71,623,158	V483A	probably damaging	Het
Dcdc2b	T	C	4: 129,610,311		probably null	Het
Dsg2	A	T	18: 20,591,853	T439S	probably benign	Het
Dtx1	A	G	5: 120,682,624	Y455H	probably damaging	Het
Frmpd1	C	A	4: 45,284,899	S1240*	probably null	Het
Gypa	T	A	8: 80,500,931	H69Q	unknown	Het
Mfap5	G	A	6: 122,525,992	V54I	probably damaging	Het
Mroh7	C	T	4: 106,703,184	G641E	probably damaging	Het
Mvd	C	T	8: 122,439,703	R65H	probably benign	Het
Olfr293	A	G	7: 86,664,294	S211G	probably benign	Het
Pigs	T	A	11: 78,340,038	N370K	probably damaging	Het
Pkd1	A	G	17: 24,581,276	T3004A	possibly damaging	Het
Pkhd1	T	A	1: 20,209,246	R2949S	probably damaging	Het
Rfc4	G	T	16: 23,115,428	Q208K	probably benign	Het
Rpa2	T	C	4: 132,770,582	S52P	probably damaging	Het
Sirpb1c	G	T	3: 15,838,758	T94K	possibly damaging	Het
Sis	A	T	3: 72,921,437	N1136K	probably damaging	Het
Spp2	T	A	1: 88,420,680		probably null	Het
Ubr3	C	T	2: 69,951,362	T628I	probably damaging	Het
Vmn1r213	A	G	13: 23,011,649	H134R	probably damaging	Het
Vmn2r59	T	C	7: 42,012,298	R698G	probably benign	Het

Other mutations in Ptpro

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ptpro	APN	6	137394909	critical splice donor site	probably null
IGL00844:Ptpro	APN	6	137414239	missense	probably damaging	1.00
IGL00983:Ptpro	APN	6	137418248	missense	probably benign	0.01
IGL01073:Ptpro	APN	6	137377088	missense	probably damaging	1.00
IGL01832:Ptpro	APN	6	137393668	missense	possibly damaging	0.93
IGL02308:Ptpro	APN	6	137454700	missense	probably benign	0.37
IGL02387:Ptpro	APN	6	137410980	missense	probably damaging	0.96
IGL02605:Ptpro	APN	6	137380318	missense	probably benign	0.02
IGL02666:Ptpro	APN	6	137378059	missense	probably damaging	0.96
IGL03275:Ptpro	APN	6	137450006	missense	probably damaging	1.00
Brau	UTSW	6	137454598	missense	probably damaging	1.00
court	UTSW	6	137393675	nonsense	probably null
Hoff	UTSW	6	137443594	missense	probably damaging	1.00
Jester	UTSW	6	137449917	missense	probably damaging	1.00
mann	UTSW	6	137411116	splice site	probably null
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0020:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0022:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0023:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0024:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0103:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0106:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0316:Ptpro	UTSW	6	137376989	missense	possibly damaging	0.81
R0427:Ptpro	UTSW	6	137368296	missense	possibly damaging	0.81
R0456:Ptpro	UTSW	6	137414230	missense	probably benign	0.04
R0536:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0537:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0552:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0555:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0664:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0708:Ptpro	UTSW	6	137386253	missense	probably benign	0.26
R0730:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0735:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0738:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0786:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0811:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0812:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0881:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0973:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1259:Ptpro	UTSW	6	137392741	missense	probably damaging	0.98
R1340:Ptpro	UTSW	6	137441081	missense	possibly damaging	0.95
R1381:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1382:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1385:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1396:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1401:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1416:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1422:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1448:Ptpro	UTSW	6	137441116	missense	probably damaging	1.00
R1513:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1518:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1526:Ptpro	UTSW	6	137461726	missense	probably damaging	1.00
R1540:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1571:Ptpro	UTSW	6	137378130	missense	probably benign
R1573:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1587:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1588:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1649:Ptpro	UTSW	6	137444017	nonsense	probably null
R1700:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1701:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1745:Ptpro	UTSW	6	137400645	missense	probably benign	0.03
R1772:Ptpro	UTSW	6	137430743	missense	probably damaging	1.00
R1911:Ptpro	UTSW	6	137400619	splice site	probably benign
R1958:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1967:Ptpro	UTSW	6	137416865	missense	probably benign	0.38
R2025:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2026:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2040:Ptpro	UTSW	6	137386164	splice site	probably benign
R2115:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2117:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2130:Ptpro	UTSW	6	137411116	splice site	probably null
R2161:Ptpro	UTSW	6	137449887	missense	probably benign	0.01
R2431:Ptpro	UTSW	6	137443585	nonsense	probably null
R2915:Ptpro	UTSW	6	137414241	start gained	probably benign
R2988:Ptpro	UTSW	6	137443599	nonsense	probably null
R3772:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3773:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3795:Ptpro	UTSW	6	137380309	missense	probably benign
R3885:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3886:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3887:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3888:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3893:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4032:Ptpro	UTSW	6	137461742	missense	probably damaging	1.00
R4133:Ptpro	UTSW	6	137420372	missense	probably damaging	1.00
R4377:Ptpro	UTSW	6	137380266	missense	probably benign	0.26
R4455:Ptpro	UTSW	6	137393659	missense	probably damaging	1.00
R4613:Ptpro	UTSW	6	137416836	nonsense	probably null
R4827:Ptpro	UTSW	6	137442710	missense	probably damaging	1.00
R4863:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4870:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R4910:Ptpro	UTSW	6	137368338	missense	probably damaging	0.99
R4932:Ptpro	UTSW	6	137411105	nonsense	probably null
R4941:Ptpro	UTSW	6	137392765	missense	probably damaging	1.00
R4989:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5009:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R5032:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5033:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5162:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5393:Ptpro	UTSW	6	137380224	missense	probably benign	0.04
R5423:Ptpro	UTSW	6	137442707	missense	probably damaging	1.00
R5782:Ptpro	UTSW	6	137399498	missense	possibly damaging	0.80
R6103:Ptpro	UTSW	6	137400706	missense	possibly damaging	0.76
R6239:Ptpro	UTSW	6	137380608	missense	probably benign	0.28
R6488:Ptpro	UTSW	6	137393675	nonsense	probably null
R6494:Ptpro	UTSW	6	137382642	missense	probably benign	0.20
R6746:Ptpro	UTSW	6	137394823	missense	probably damaging	1.00
R6763:Ptpro	UTSW	6	137418281	splice site	probably null
R6888:Ptpro	UTSW	6	137380200	missense	probably benign	0.30
R6983:Ptpro	UTSW	6	137449917	missense	probably damaging	1.00
R7019:Ptpro	UTSW	6	137380478	missense	probably benign
R7218:Ptpro	UTSW	6	137454598	missense	probably damaging	1.00
R7236:Ptpro	UTSW	6	137368337	missense	probably damaging	1.00
R7299:Ptpro	UTSW	6	137441144	critical splice donor site	probably null
R7381:Ptpro	UTSW	6	137399561	missense	possibly damaging	0.93
R7493:Ptpro	UTSW	6	137382649	missense	probably benign	0.01
R7733:Ptpro	UTSW	6	137414286	nonsense	probably null
R7793:Ptpro	UTSW	6	137416820	missense	probably damaging	0.99
R7804:Ptpro	UTSW	6	137399601	splice site	probably null
R7833:Ptpro	UTSW	6	137416863	nonsense	probably null
R7859:Ptpro	UTSW	6	137392807	critical splice donor site	probably null
R7873:Ptpro	UTSW	6	137430739	missense	probably benign	0.44
R8042:Ptpro	UTSW	6	137416883	missense	possibly damaging	0.71
R8859:Ptpro	UTSW	6	137426784	nonsense	probably null
R8979:Ptpro	UTSW	6	137368142	missense	probably benign
R9138:Ptpro	UTSW	6	137411115	critical splice donor site	probably null
R9309:Ptpro	UTSW	6	137454658	missense	probably damaging	1.00
R9420:Ptpro	UTSW	6	137443935	missense	probably benign	0.08
R9612:Ptpro	UTSW	6	137414320	missense	probably benign	0.31
R9625:Ptpro	UTSW	6	137394875	missense	probably damaging	1.00
R9697:Ptpro	UTSW	6	137386290	missense	probably damaging	1.00
R9715:Ptpro	UTSW	6	137368110	missense	probably damaging	0.96
Z1177:Ptpro	UTSW	6	137378140	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAAACCTCAGCATGTGAGTGTCC -3'
(R):5'- ACACAGAAGGCAACTGCTCTTGG -3'

Sequencing Primer
(F):5'- AGCATGTGAGTGTCCACGTC -3'
(R):5'- AATGGGTACGTGACCTCTAAC -3'

Posted On

2013-08-06