Incidental Mutation 'R8260:Ahcyl'
ID 640041
Institutional Source Beutler Lab
Gene Symbol Ahcyl
Ensembl Gene ENSMUSG00000048087
Gene Name adenosylhomocysteinase like
Synonyms Gm4737
MMRRC Submission 067685-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.945) question?
Stock # R8260 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45973348-45975440 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45974786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 197 (E197G)
Ref Sequence ENSEMBL: ENSMUSP00000127198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000059524
AA Change: E197G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127198
Gene: ENSMUSG00000048087
AA Change: E197G

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 64,223,633 (GRCm39) L48V probably benign Het
Acbd3 T C 1: 180,566,095 (GRCm39) Y263H probably damaging Het
Acot4 C A 12: 84,088,809 (GRCm39) P219Q possibly damaging Het
Adcy6 A G 15: 98,498,919 (GRCm39) F294S probably damaging Het
Aplf T C 6: 87,606,987 (GRCm39) R476G probably benign Het
Arid1b A G 17: 5,382,788 (GRCm39) T1292A probably benign Het
Atp2c1 T A 9: 105,295,778 (GRCm39) I649F probably damaging Het
Bbs10 C T 10: 111,136,104 (GRCm39) Q406* probably null Het
Bcas3 T A 11: 85,400,372 (GRCm39) M447K possibly damaging Het
Bmal1 A T 7: 112,884,258 (GRCm39) I92F probably damaging Het
Cars1 T C 7: 143,139,446 (GRCm39) D214G probably benign Het
Ccdc88a A T 11: 29,443,934 (GRCm39) I1410F probably benign Het
Cd55b A T 1: 130,316,415 (GRCm39) L378H probably damaging Het
Cdh1 G A 8: 107,330,979 (GRCm39) E37K probably benign Het
Cep72 T C 13: 74,206,465 (GRCm39) Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,879 (GRCm39) T176A possibly damaging Het
D630045J12Rik T A 6: 38,119,846 (GRCm39) probably null Het
Ddi1 A T 9: 6,265,524 (GRCm39) C282S probably damaging Het
Ddit4 T C 10: 59,787,277 (GRCm39) T20A probably benign Het
Dpp10 T A 1: 123,614,024 (GRCm39) T102S probably benign Het
Ep400 T A 5: 110,903,478 (GRCm39) K374* probably null Het
Epha3 A G 16: 63,403,917 (GRCm39) L728P probably damaging Het
Fbxw21 C A 9: 108,975,614 (GRCm39) probably null Het
Frmpd1 A G 4: 45,244,638 (GRCm39) E109G probably damaging Het
Ggt1 C T 10: 75,417,245 (GRCm39) P332L probably damaging Het
Gm4779 G C X: 100,837,390 (GRCm39) T171S possibly damaging Het
Gm5431 A T 11: 48,785,556 (GRCm39) I273K probably benign Het
Gon4l A G 3: 88,799,937 (GRCm39) N861D probably damaging Het
Grm5 T C 7: 87,724,340 (GRCm39) probably null Het
Helt T C 8: 46,745,745 (GRCm39) N84S possibly damaging Het
Hnrnpa0 G T 13: 58,275,228 (GRCm39) Y300* probably null Het
Ints1 T C 5: 139,750,968 (GRCm39) T810A Het
Irf2bp1 C T 7: 18,740,079 (GRCm39) A573V possibly damaging Het
Itgbl1 C A 14: 124,065,246 (GRCm39) D133E probably benign Het
Kctd15 A G 7: 34,344,267 (GRCm39) F128S possibly damaging Het
Klra17 T A 6: 129,808,421 (GRCm39) N271Y probably damaging Het
Kmt2c T A 5: 25,610,514 (GRCm39) E197D possibly damaging Het
Larp1 C A 11: 57,949,515 (GRCm39) T1048K probably benign Het
Macf1 A G 4: 123,365,863 (GRCm39) V2966A probably benign Het
Magi3 A G 3: 103,922,625 (GRCm39) L1364P probably benign Het
Malrd1 T C 2: 15,619,017 (GRCm39) S294P Het
Med13l C T 5: 118,886,794 (GRCm39) T1565I possibly damaging Het
Mov10l1 A G 15: 88,896,313 (GRCm39) D719G probably benign Het
Mtcl3 T A 10: 29,024,270 (GRCm39) H395Q possibly damaging Het
Muc4 CAC CACTAC 16: 32,575,367 (GRCm39) probably benign Het
Myh14 T C 7: 44,264,800 (GRCm39) E1654G probably damaging Het
Myo1c C T 11: 75,546,942 (GRCm39) probably benign Het
Myo9a A G 9: 59,817,961 (GRCm39) T2343A probably benign Het
Or1j12 A G 2: 36,342,897 (GRCm39) Q100R probably damaging Het
Or2ag18 A T 7: 106,405,234 (GRCm39) V145E possibly damaging Het
Or2d2b A T 7: 106,706,062 (GRCm39) M2K probably benign Het
Or4m1 T C 14: 50,557,615 (GRCm39) K226E probably benign Het
Or52m2 T A 7: 102,263,432 (GRCm39) I255F possibly damaging Het
Or52n5 T A 7: 104,587,879 (GRCm39) Y49N probably damaging Het
Or6c2 T A 10: 129,362,957 (GRCm39) I287N possibly damaging Het
Or8k53 T A 2: 86,177,276 (GRCm39) Y278F possibly damaging Het
Or9g3 A T 2: 85,589,820 (GRCm39) L300Q probably damaging Het
Osmr A T 15: 6,844,897 (GRCm39) D957E probably benign Het
Pappa T A 4: 65,234,419 (GRCm39) V1408E probably damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pdcd6ip A T 9: 113,501,865 (GRCm39) D464E probably benign Het
Pde1c T C 6: 56,114,404 (GRCm39) Y503C probably benign Het
Potefam3d A T 8: 69,972,400 (GRCm39) D116E possibly damaging Het
Prob1 T A 18: 35,787,210 (GRCm39) E348V possibly damaging Het
Rnls A G 19: 33,180,048 (GRCm39) L134S probably damaging Het
Scrn3 T C 2: 73,166,202 (GRCm39) Y412H probably damaging Het
Serpina3g T C 12: 104,205,362 (GRCm39) S34P probably benign Het
Sertad3 G A 7: 27,175,784 (GRCm39) A73T probably benign Het
Sez6l C T 5: 112,609,122 (GRCm39) A576T probably benign Het
Sh3tc2 G A 18: 62,146,137 (GRCm39) R1172H probably damaging Het
Sirt3 A G 7: 140,456,319 (GRCm39) V110A Het
Smpd3 A T 8: 106,984,047 (GRCm39) D557E probably benign Het
Sptssb A T 3: 69,728,305 (GRCm39) M44K probably damaging Het
Tars2 A G 3: 95,662,132 (GRCm39) W7R probably damaging Het
Tbc1d9b A G 11: 50,055,013 (GRCm39) D964G probably benign Het
Tiam2 A T 17: 3,568,594 (GRCm39) D1580V possibly damaging Het
Tmeff2 T A 1: 50,977,478 (GRCm39) V130D probably damaging Het
Top2a T A 11: 98,891,595 (GRCm39) E1176V probably null Het
Trappc9 C A 15: 72,813,758 (GRCm39) E680* probably null Het
Trip10 A G 17: 57,564,314 (GRCm39) N355S probably benign Het
Ttn T C 2: 76,596,337 (GRCm39) E20192G probably damaging Het
Vmn2r96 A G 17: 18,804,243 (GRCm39) M306V probably benign Het
Wdr90 A T 17: 26,064,141 (GRCm39) H1860Q probably damaging Het
Wrnip1 A G 13: 32,989,339 (GRCm39) I276V possibly damaging Het
Zfp608 T C 18: 55,030,821 (GRCm39) K1040E possibly damaging Het
Zfp808 T A 13: 62,320,552 (GRCm39) C594S probably benign Het
Other mutations in Ahcyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Ahcyl APN 16 45,974,441 (GRCm39) missense probably benign
IGL03347:Ahcyl APN 16 45,974,852 (GRCm39) missense probably benign 0.01
R0326:Ahcyl UTSW 16 45,974,246 (GRCm39) missense probably benign 0.03
R0552:Ahcyl UTSW 16 45,974,955 (GRCm39) missense probably benign
R0610:Ahcyl UTSW 16 45,974,264 (GRCm39) missense probably damaging 1.00
R1465:Ahcyl UTSW 16 45,974,211 (GRCm39) missense probably benign 0.01
R1465:Ahcyl UTSW 16 45,974,211 (GRCm39) missense probably benign 0.01
R1473:Ahcyl UTSW 16 45,975,182 (GRCm39) missense probably damaging 1.00
R2997:Ahcyl UTSW 16 45,974,288 (GRCm39) missense possibly damaging 0.83
R4546:Ahcyl UTSW 16 45,974,330 (GRCm39) missense possibly damaging 0.81
R4818:Ahcyl UTSW 16 45,974,555 (GRCm39) missense probably damaging 1.00
R6544:Ahcyl UTSW 16 45,975,147 (GRCm39) missense probably benign
R7358:Ahcyl UTSW 16 45,974,201 (GRCm39) missense probably damaging 1.00
R7689:Ahcyl UTSW 16 45,974,970 (GRCm39) missense probably benign 0.12
R9041:Ahcyl UTSW 16 45,974,468 (GRCm39) missense possibly damaging 0.86
R9048:Ahcyl UTSW 16 45,974,558 (GRCm39) missense probably damaging 1.00
R9601:Ahcyl UTSW 16 45,975,035 (GRCm39) missense probably benign 0.40
R9655:Ahcyl UTSW 16 45,974,564 (GRCm39) missense probably damaging 1.00
R9794:Ahcyl UTSW 16 45,974,342 (GRCm39) missense probably benign 0.17
Z1176:Ahcyl UTSW 16 45,974,592 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACAGGCTTCGTCCATAGTGG -3'
(R):5'- GGTGACCTTACTAACCTCATCCAC -3'

Sequencing Primer
(F):5'- GTCCATAGTGGTTACCTCATAGC -3'
(R):5'- CACCAAATACCCACAGCTTCTGTC -3'
Posted On 2020-07-28