Incidental Mutation 'R8260:Tiam2'
ID640043
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8260 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3518319 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1580 (D1580V)
Ref Sequence ENSEMBL: ENSMUSP00000072020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838]
PDB Structure Crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Low-resolution crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072156
AA Change: D1580V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: D1580V

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169838
AA Change: D1580V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: D1580V

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 63,986,184 L48V probably benign Het
Acbd3 T C 1: 180,738,530 Y263H probably damaging Het
Acot4 C A 12: 84,042,035 P219Q possibly damaging Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Arid1b A G 17: 5,332,513 T1292A probably benign Het
Arntl A T 7: 113,285,051 I92F probably damaging Het
Atp2c1 T A 9: 105,418,579 I649F probably damaging Het
Bbs10 C T 10: 111,300,243 Q406* probably null Het
Bcas3 T A 11: 85,509,546 M447K possibly damaging Het
Cars T C 7: 143,585,709 D214G probably benign Het
Ccdc88a A T 11: 29,493,934 I1410F probably benign Het
Cd55b A T 1: 130,388,678 L378H probably damaging Het
Cdh1 G A 8: 106,604,347 E37K probably benign Het
Cep72 T C 13: 74,058,346 Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,733 T176A possibly damaging Het
D630045J12Rik T A 6: 38,142,911 probably null Het
Ddi1 A T 9: 6,265,524 C282S probably damaging Het
Ddit4 T C 10: 59,951,455 T20A probably benign Het
Dpp10 T A 1: 123,686,295 T102S probably benign Het
Ep400 T A 5: 110,755,612 K374* probably null Het
Epha3 A G 16: 63,583,554 L728P probably damaging Het
Fbxw21 C A 9: 109,146,546 probably null Het
Frmpd1 A G 4: 45,244,638 E109G probably damaging Het
Ggt1 C T 10: 75,581,411 P332L probably damaging Het
Gm10081 A T 7: 107,106,855 M2K probably benign Het
Gm4737 T C 16: 46,154,423 E197G probably damaging Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Gm5431 A T 11: 48,894,729 I273K probably benign Het
Gm7697 A T 8: 69,519,748 D116E possibly damaging Het
Gon4l A G 3: 88,892,630 N861D probably damaging Het
Grm5 T C 7: 88,075,132 probably null Het
Helt T C 8: 46,292,708 N84S possibly damaging Het
Hnrnpa0 G T 13: 58,127,414 Y300* probably null Het
Ints1 T C 5: 139,765,213 T810A Het
Irf2bp1 C T 7: 19,006,154 A573V possibly damaging Het
Itgbl1 C A 14: 123,827,834 D133E probably benign Het
Kctd15 A G 7: 34,644,842 F128S possibly damaging Het
Klra17 T A 6: 129,831,458 N271Y probably damaging Het
Kmt2c T A 5: 25,405,516 E197D possibly damaging Het
Larp1 C A 11: 58,058,689 T1048K probably benign Het
Macf1 A G 4: 123,472,070 V2966A probably benign Het
Magi3 A G 3: 104,015,309 L1364P probably benign Het
Malrd1 T C 2: 15,614,206 S294P Het
Med13l C T 5: 118,748,729 T1565I possibly damaging Het
Mov10l1 A G 15: 89,012,110 D719G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh14 T C 7: 44,615,376 E1654G probably damaging Het
Myo1c C T 11: 75,656,116 probably benign Het
Myo9a A G 9: 59,910,678 T2343A probably benign Het
Olfr1012 A T 2: 85,759,476 L300Q probably damaging Het
Olfr1055 T A 2: 86,346,932 Y278F possibly damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr553 T A 7: 102,614,225 I255F possibly damaging Het
Olfr669 T A 7: 104,938,672 Y49N probably damaging Het
Olfr700 A T 7: 106,806,027 V145E possibly damaging Het
Olfr734 T C 14: 50,320,158 K226E probably benign Het
Olfr791 T A 10: 129,527,088 I287N possibly damaging Het
Osmr A T 15: 6,815,416 D957E probably benign Het
Pappa T A 4: 65,316,182 V1408E probably damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pdcd6ip A T 9: 113,672,797 D464E probably benign Het
Pde1c T C 6: 56,137,419 Y503C probably benign Het
Prob1 T A 18: 35,654,157 E348V possibly damaging Het
Rnls A G 19: 33,202,648 L134S probably damaging Het
Scrn3 T C 2: 73,335,858 Y412H probably damaging Het
Serpina3g T C 12: 104,239,103 S34P probably benign Het
Sertad3 G A 7: 27,476,359 A73T probably benign Het
Sez6l C T 5: 112,461,256 A576T probably benign Het
Sh3tc2 G A 18: 62,013,066 R1172H probably damaging Het
Sirt3 A G 7: 140,876,406 V110A Het
Smpd3 A T 8: 106,257,415 D557E probably benign Het
Soga3 T A 10: 29,148,274 H395Q possibly damaging Het
Sptssb A T 3: 69,820,972 M44K probably damaging Het
Tars2 A G 3: 95,754,820 W7R probably damaging Het
Tbc1d9b A G 11: 50,164,186 D964G probably benign Het
Tmeff2 T A 1: 50,938,319 V130D probably damaging Het
Top2a T A 11: 99,000,769 E1176V probably null Het
Trappc9 C A 15: 72,941,909 E680* probably null Het
Trip10 A G 17: 57,257,314 N355S probably benign Het
Ttn T C 2: 76,765,993 E20192G probably damaging Het
Vmn2r96 A G 17: 18,583,981 M306V probably benign Het
Wdr90 A T 17: 25,845,167 H1860Q probably damaging Het
Wrnip1 A G 13: 32,805,356 I276V possibly damaging Het
Zfp608 T C 18: 54,897,749 K1040E possibly damaging Het
Zfp808 T A 13: 62,172,738 C594S probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3518585 missense probably damaging 0.99
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3518262 missense probably benign 0.05
R8530:Tiam2 UTSW 17 3450812 missense probably benign 0.03
R8692:Tiam2 UTSW 17 3428807 missense probably damaging 1.00
R8902:Tiam2 UTSW 17 3477196 missense probably benign 0.00
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACTCTGTTCCGTGTC -3'
(R):5'- GCTGTTCACCTGACTCTGTGAG -3'

Sequencing Primer
(F):5'- TCGTTGAAGGGCCTCAGAACATC -3'
(R):5'- CTCTGTGAGAGGCTGCTGC -3'
Posted On2020-07-28