Incidental Mutation 'R8260:Wdr90'
ID640046
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R8260 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25845167 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1860 (H1860Q)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079461
AA Change: H1860Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: H1860Q

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect possibly damaging
Transcript: ENSMUST00000176923
AA Change: H1842Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: H1842Q

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 63,986,184 L48V probably benign Het
Acbd3 T C 1: 180,738,530 Y263H probably damaging Het
Acot4 C A 12: 84,042,035 P219Q possibly damaging Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Arid1b A G 17: 5,332,513 T1292A probably benign Het
Arntl A T 7: 113,285,051 I92F probably damaging Het
Atp2c1 T A 9: 105,418,579 I649F probably damaging Het
Bbs10 C T 10: 111,300,243 Q406* probably null Het
Bcas3 T A 11: 85,509,546 M447K possibly damaging Het
Cars T C 7: 143,585,709 D214G probably benign Het
Ccdc88a A T 11: 29,493,934 I1410F probably benign Het
Cd55b A T 1: 130,388,678 L378H probably damaging Het
Cdh1 G A 8: 106,604,347 E37K probably benign Het
Cep72 T C 13: 74,058,346 Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,733 T176A possibly damaging Het
D630045J12Rik T A 6: 38,142,911 probably null Het
Ddi1 A T 9: 6,265,524 C282S probably damaging Het
Ddit4 T C 10: 59,951,455 T20A probably benign Het
Dpp10 T A 1: 123,686,295 T102S probably benign Het
Ep400 T A 5: 110,755,612 K374* probably null Het
Epha3 A G 16: 63,583,554 L728P probably damaging Het
Fbxw21 C A 9: 109,146,546 probably null Het
Frmpd1 A G 4: 45,244,638 E109G probably damaging Het
Ggt1 C T 10: 75,581,411 P332L probably damaging Het
Gm10081 A T 7: 107,106,855 M2K probably benign Het
Gm4737 T C 16: 46,154,423 E197G probably damaging Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Gm5431 A T 11: 48,894,729 I273K probably benign Het
Gm7697 A T 8: 69,519,748 D116E possibly damaging Het
Gon4l A G 3: 88,892,630 N861D probably damaging Het
Grm5 T C 7: 88,075,132 probably null Het
Helt T C 8: 46,292,708 N84S possibly damaging Het
Hnrnpa0 G T 13: 58,127,414 Y300* probably null Het
Ints1 T C 5: 139,765,213 T810A Het
Irf2bp1 C T 7: 19,006,154 A573V possibly damaging Het
Itgbl1 C A 14: 123,827,834 D133E probably benign Het
Kctd15 A G 7: 34,644,842 F128S possibly damaging Het
Klra17 T A 6: 129,831,458 N271Y probably damaging Het
Kmt2c T A 5: 25,405,516 E197D possibly damaging Het
Larp1 C A 11: 58,058,689 T1048K probably benign Het
Macf1 A G 4: 123,472,070 V2966A probably benign Het
Magi3 A G 3: 104,015,309 L1364P probably benign Het
Malrd1 T C 2: 15,614,206 S294P Het
Med13l C T 5: 118,748,729 T1565I possibly damaging Het
Mov10l1 A G 15: 89,012,110 D719G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh14 T C 7: 44,615,376 E1654G probably damaging Het
Myo1c C T 11: 75,656,116 probably benign Het
Myo9a A G 9: 59,910,678 T2343A probably benign Het
Olfr1012 A T 2: 85,759,476 L300Q probably damaging Het
Olfr1055 T A 2: 86,346,932 Y278F possibly damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr553 T A 7: 102,614,225 I255F possibly damaging Het
Olfr669 T A 7: 104,938,672 Y49N probably damaging Het
Olfr700 A T 7: 106,806,027 V145E possibly damaging Het
Olfr734 T C 14: 50,320,158 K226E probably benign Het
Olfr791 T A 10: 129,527,088 I287N possibly damaging Het
Osmr A T 15: 6,815,416 D957E probably benign Het
Pappa T A 4: 65,316,182 V1408E probably damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pdcd6ip A T 9: 113,672,797 D464E probably benign Het
Pde1c T C 6: 56,137,419 Y503C probably benign Het
Prob1 T A 18: 35,654,157 E348V possibly damaging Het
Rnls A G 19: 33,202,648 L134S probably damaging Het
Scrn3 T C 2: 73,335,858 Y412H probably damaging Het
Serpina3g T C 12: 104,239,103 S34P probably benign Het
Sertad3 G A 7: 27,476,359 A73T probably benign Het
Sez6l C T 5: 112,461,256 A576T probably benign Het
Sh3tc2 G A 18: 62,013,066 R1172H probably damaging Het
Sirt3 A G 7: 140,876,406 V110A Het
Smpd3 A T 8: 106,257,415 D557E probably benign Het
Soga3 T A 10: 29,148,274 H395Q possibly damaging Het
Sptssb A T 3: 69,820,972 M44K probably damaging Het
Tars2 A G 3: 95,754,820 W7R probably damaging Het
Tbc1d9b A G 11: 50,164,186 D964G probably benign Het
Tiam2 A T 17: 3,518,319 D1580V possibly damaging Het
Tmeff2 T A 1: 50,938,319 V130D probably damaging Het
Top2a T A 11: 99,000,769 E1176V probably null Het
Trappc9 C A 15: 72,941,909 E680* probably null Het
Trip10 A G 17: 57,257,314 N355S probably benign Het
Ttn T C 2: 76,765,993 E20192G probably damaging Het
Vmn2r96 A G 17: 18,583,981 M306V probably benign Het
Wrnip1 A G 13: 32,805,356 I276V possibly damaging Het
Zfp608 T C 18: 54,897,749 K1040E possibly damaging Het
Zfp808 T A 13: 62,172,738 C594S probably benign Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R8126:Wdr90 UTSW 17 25848977 missense possibly damaging 0.48
R8315:Wdr90 UTSW 17 25845425 missense probably benign 0.21
R8919:Wdr90 UTSW 17 25857172 missense
R8938:Wdr90 UTSW 17 25857172 missense
R8940:Wdr90 UTSW 17 25857172 missense
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGAAGCCTGTCCCAG -3'
(R):5'- ATCTCAGCTCATGGTGGTTG -3'

Sequencing Primer
(F):5'- TGAAGCCTGTCCCAGCCATC -3'
(R):5'- TGCTGGTCGACACACATAG -3'
Posted On2020-07-28