Incidental Mutation 'R0094:Gypa'
ID64008
Institutional Source Beutler Lab
Gene Symbol Gypa
Ensembl Gene ENSMUSG00000051839
Gene Nameglycophorin A
SynonymsCD235a, GPA
MMRRC Submission 038380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0094 (G1)
Quality Score84
Status Not validated
Chromosome8
Chromosomal Location80493781-80510542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80500931 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 69 (H69Q)
Ref Sequence ENSEMBL: ENSMUSP00000070836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063359]
Predicted Effect unknown
Transcript: ENSMUST00000063359
AA Change: H69Q
SMART Domains Protein: ENSMUSP00000070836
Gene: ENSMUSG00000051839
AA Change: H69Q

DomainStartEndE-ValueType
Pfam:Glycophorin_A 43 162 2.5e-53 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, mutant erythrocytes had a reduced percentage of O-linked glycoproteins in the membranes, and were sensitive to hypoosmotic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,306,886 T185S possibly damaging Het
Amotl1 A G 9: 14,575,387 S441P probably benign Het
Ap5z1 G A 5: 142,476,812 V626M probably benign Het
Cacna2d3 C T 14: 29,170,503 probably null Het
Cfap77 A T 2: 28,984,434 V128D probably damaging Het
Colgalt1 T C 8: 71,623,158 V483A probably damaging Het
Dcdc2b T C 4: 129,610,311 probably null Het
Dsg2 A T 18: 20,591,853 T439S probably benign Het
Dtx1 A G 5: 120,682,624 Y455H probably damaging Het
Frmpd1 C A 4: 45,284,899 S1240* probably null Het
Mfap5 G A 6: 122,525,992 V54I probably damaging Het
Mroh7 C T 4: 106,703,184 G641E probably damaging Het
Mvd C T 8: 122,439,703 R65H probably benign Het
Olfr293 A G 7: 86,664,294 S211G probably benign Het
Pigs T A 11: 78,340,038 N370K probably damaging Het
Pkd1 A G 17: 24,581,276 T3004A possibly damaging Het
Pkhd1 T A 1: 20,209,246 R2949S probably damaging Het
Ptpro T C 6: 137,386,352 Y495H probably benign Het
Rfc4 G T 16: 23,115,428 Q208K probably benign Het
Rpa2 T C 4: 132,770,582 S52P probably damaging Het
Sirpb1c G T 3: 15,838,758 T94K possibly damaging Het
Sis A T 3: 72,921,437 N1136K probably damaging Het
Spp2 T A 1: 88,420,680 probably null Het
Ubr3 C T 2: 69,951,362 T628I probably damaging Het
Vmn1r213 A G 13: 23,011,649 H134R probably damaging Het
Vmn2r59 T C 7: 42,012,298 R698G probably benign Het
Other mutations in Gypa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Gypa APN 8 80504779 splice site probably benign
IGL02283:Gypa APN 8 80494092 splice site probably benign
R0067:Gypa UTSW 8 80503081 missense possibly damaging 0.71
R0563:Gypa UTSW 8 80509460 missense probably benign 0.04
R0685:Gypa UTSW 8 80496702 splice site probably benign
R0729:Gypa UTSW 8 80496792 missense unknown
R0850:Gypa UTSW 8 80496345 missense unknown
R1299:Gypa UTSW 8 80496753 missense unknown
R2435:Gypa UTSW 8 80506768 splice site probably null
R4998:Gypa UTSW 8 80496335 missense unknown
R5121:Gypa UTSW 8 80496348 missense unknown
R6295:Gypa UTSW 8 80496340 missense unknown
R6827:Gypa UTSW 8 80504788 missense probably benign 0.00
Z1177:Gypa UTSW 8 80500998 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTCCATGCAGTCTAAGTCTGGTG -3'
(R):5'- ATCATTCGAGGTCTGTAGGGGAGC -3'

Sequencing Primer
(F):5'- GGTGAAATACAATCATGCCGTCTG -3'
(R):5'- ACAGCAGGAACCTGTGC -3'
Posted On2013-08-06