Incidental Mutation 'R8258:Ranbp2'
ID640080
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8258 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58455933 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 254 (E254G)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably benign
Transcript: ENSMUST00000003310
AA Change: E254G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: E254G

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Lexm C T 4: 106,591,662 G400S probably damaging Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
R7727:Ranbp2 UTSW 10 58455438 missense probably benign 0.09
R7795:Ranbp2 UTSW 10 58483907 nonsense probably null
R7812:Ranbp2 UTSW 10 58467402 missense probably benign
R7845:Ranbp2 UTSW 10 58447022 missense probably damaging 1.00
R7875:Ranbp2 UTSW 10 58478455 nonsense probably null
R7934:Ranbp2 UTSW 10 58476475 missense probably damaging 0.98
R8022:Ranbp2 UTSW 10 58485861 missense possibly damaging 0.53
R8050:Ranbp2 UTSW 10 58479619 missense probably damaging 0.99
R8100:Ranbp2 UTSW 10 58490648 missense possibly damaging 0.58
R8194:Ranbp2 UTSW 10 58455925 missense possibly damaging 0.84
R8259:Ranbp2 UTSW 10 58455933 missense probably benign 0.04
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Z1176:Ranbp2 UTSW 10 58461886 missense probably damaging 1.00
Z1177:Ranbp2 UTSW 10 58493891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCAAGTAGTTTGTAGGGATACAG -3'
(R):5'- GCATGTGACACCTCATACATAAAAG -3'

Sequencing Primer
(F):5'- GGGATACAGTGGTCAATTTTTCAAAG -3'
(R):5'- GTGACACCTCATACATAAAAGAATGG -3'
Posted On2020-07-28