Incidental Mutation 'R8258:Ggt5'
ID640082
Institutional Source Beutler Lab
Gene Symbol Ggt5
Ensembl Gene ENSMUSG00000006344
Gene Namegamma-glutamyltransferase 5
SynonymsGGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8258 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75589340-75617200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75614832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 558 (V558I)
Ref Sequence ENSEMBL: ENSMUSP00000072074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072217]
Predicted Effect probably benign
Transcript: ENSMUST00000072217
AA Change: V558I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: V558I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Lexm C T 4: 106,591,662 G400S probably damaging Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Ggt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Ggt5 APN 10 75610110 splice site probably benign
IGL01926:Ggt5 APN 10 75604101 missense probably benign 0.00
IGL02095:Ggt5 APN 10 75608803 missense probably benign 0.01
IGL02252:Ggt5 APN 10 75602732 missense possibly damaging 0.51
IGL02393:Ggt5 APN 10 75610237 splice site probably benign
IGL02515:Ggt5 APN 10 75589770 missense probably benign 0.23
IGL02528:Ggt5 APN 10 75610420 splice site probably benign
IGL02964:Ggt5 APN 10 75604128 missense probably benign 0.08
R0646:Ggt5 UTSW 10 75602648 missense probably damaging 0.99
R0834:Ggt5 UTSW 10 75604770 missense possibly damaging 0.73
R1454:Ggt5 UTSW 10 75609908 missense probably benign 0.01
R1650:Ggt5 UTSW 10 75604761 missense probably benign 0.00
R1846:Ggt5 UTSW 10 75610542 splice site probably null
R1896:Ggt5 UTSW 10 75604726 missense probably damaging 1.00
R2044:Ggt5 UTSW 10 75604087 missense probably damaging 0.97
R2357:Ggt5 UTSW 10 75609241 missense probably benign 0.19
R3151:Ggt5 UTSW 10 75609242 missense probably benign 0.35
R4667:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R4669:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R5060:Ggt5 UTSW 10 75604774 missense probably benign
R5756:Ggt5 UTSW 10 75604773 missense probably benign
R6156:Ggt5 UTSW 10 75609326 missense probably damaging 1.00
R6162:Ggt5 UTSW 10 75589792 missense possibly damaging 0.92
R6900:Ggt5 UTSW 10 75610537 missense possibly damaging 0.81
R8259:Ggt5 UTSW 10 75614832 missense probably benign 0.04
Z1088:Ggt5 UTSW 10 75608759 missense possibly damaging 0.81
Z1176:Ggt5 UTSW 10 75602618 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGCTTCATGATTTTAGGTC -3'
(R):5'- TGCTGAGCTGATCCTTGTTC -3'

Sequencing Primer
(F):5'- CCAGCTTCATGATTTTAGGTCTGTTG -3'
(R):5'- CTTTTTCAGTCCCAGGTTGAC -3'
Posted On2020-07-28