Incidental Mutation 'R8253:Dner'
ID640109
Institutional Source Beutler Lab
Gene Symbol Dner
Ensembl Gene ENSMUSG00000036766
Gene Namedelta/notch-like EGF repeat containing
SynonymsA930026D19Rik, BET
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location84369839-84696221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84534877 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 323 (G323E)
Ref Sequence ENSEMBL: ENSMUSP00000042927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049126]
Predicted Effect probably damaging
Transcript: ENSMUST00000049126
AA Change: G323E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: G323E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EGF 47 92 9.85e-5 SMART
EGF 97 133 2.33e-6 SMART
EGF 306 348 1.8e1 SMART
EGF 352 390 5e-6 SMART
EGF_CA 392 428 8.97e-8 SMART
EGF 433 466 3.54e-6 SMART
EGF 471 503 4.66e-6 SMART
EGF_CA 505 541 1.61e-9 SMART
EGF 546 579 9.7e-4 SMART
EGF_CA 581 617 4.52e-13 SMART
transmembrane domain 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Dner
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Dner APN 1 84384010 missense probably benign 0.13
IGL02251:Dner APN 1 84384026 missense probably damaging 1.00
IGL02904:Dner APN 1 84534944 missense probably damaging 0.96
IGL03063:Dner APN 1 84585338 missense possibly damaging 0.90
R0013:Dner UTSW 1 84494893 splice site probably benign
R0112:Dner UTSW 1 84583053 missense probably benign 0.06
R0196:Dner UTSW 1 84370832 missense probably damaging 1.00
R0282:Dner UTSW 1 84405965 missense probably damaging 1.00
R0282:Dner UTSW 1 84445380 splice site probably benign
R0942:Dner UTSW 1 84585309 splice site probably benign
R1143:Dner UTSW 1 84445464 missense probably damaging 1.00
R1483:Dner UTSW 1 84585549 utr 5 prime probably benign
R1585:Dner UTSW 1 84585456 missense probably benign 0.05
R1636:Dner UTSW 1 84585330 missense possibly damaging 0.89
R1739:Dner UTSW 1 84370784 missense probably damaging 0.99
R1756:Dner UTSW 1 84445590 missense probably damaging 0.98
R1960:Dner UTSW 1 84445456 missense probably damaging 0.98
R2061:Dner UTSW 1 84405989 missense probably damaging 1.00
R2157:Dner UTSW 1 84383938 missense possibly damaging 0.88
R2265:Dner UTSW 1 84585549 utr 5 prime probably benign
R2382:Dner UTSW 1 84370823 missense probably damaging 1.00
R2507:Dner UTSW 1 84583080 missense probably damaging 1.00
R3053:Dner UTSW 1 84384026 missense probably damaging 1.00
R3917:Dner UTSW 1 84585549 utr 5 prime probably benign
R4530:Dner UTSW 1 84583015 missense probably damaging 1.00
R4552:Dner UTSW 1 84383857 missense probably damaging 1.00
R4579:Dner UTSW 1 84383816 missense probably damaging 0.97
R4593:Dner UTSW 1 84695728 start codon destroyed probably null
R4711:Dner UTSW 1 84383897 missense possibly damaging 0.75
R5102:Dner UTSW 1 84405970 missense probably damaging 1.00
R5314:Dner UTSW 1 84580739 missense probably damaging 1.00
R5370:Dner UTSW 1 84585549 utr 5 prime probably benign
R6000:Dner UTSW 1 84383929 missense possibly damaging 0.80
R6644:Dner UTSW 1 84395707 missense probably damaging 1.00
R6764:Dner UTSW 1 84494781 missense probably damaging 1.00
R6948:Dner UTSW 1 84406017 missense probably damaging 1.00
R6991:Dner UTSW 1 84476402 nonsense probably null
R7056:Dner UTSW 1 84580736 missense possibly damaging 0.75
R7410:Dner UTSW 1 84585611 missense probably damaging 1.00
R7490:Dner UTSW 1 84585549 utr 5 prime probably benign
R7869:Dner UTSW 1 84383881 missense probably benign 0.10
R7938:Dner UTSW 1 84695497 missense possibly damaging 0.62
Z1176:Dner UTSW 1 84383980 missense possibly damaging 0.88
Z1177:Dner UTSW 1 84405989 missense probably damaging 1.00
Z1177:Dner UTSW 1 84445430 missense probably damaging 1.00
Z1177:Dner UTSW 1 84445433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATAGAACTTCTTATTCCAGTGAC -3'
(R):5'- TGACCTTCAGATGGAATTCTGTC -3'

Sequencing Primer
(F):5'- cctacatacacacacacaca -3'
(R):5'- ACCTTCAGATGGAATTCTGTCTGGAC -3'
Posted On2020-07-28