Incidental Mutation 'R8253:Avpr1b'
ID640110
Institutional Source Beutler Lab
Gene Symbol Avpr1b
Ensembl Gene ENSMUSG00000026432
Gene Namearginine vasopressin receptor 1B
SynonymsVPR3, V1bR, V3/V1b, V3/V1b pituitary vasopressin receptor, AVPR3, V1BR
Accession Numbers

Genbank: NM_011924; MGI: 1347010

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131599239-131612000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131609416 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 313 (T313S)
Ref Sequence ENSEMBL: ENSMUSP00000027690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027690] [ENSMUST00000190410]
Predicted Effect probably benign
Transcript: ENSMUST00000027690
AA Change: T313S

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027690
Gene: ENSMUSG00000026432
AA Change: T313S

DomainStartEndE-ValueType
Pfam:7tm_4 41 223 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 342 4.4e-7 PFAM
Pfam:7tm_1 51 335 1.6e-50 PFAM
Pfam:7TM_GPCR_Srv 106 352 8.2e-7 PFAM
DUF1856 359 411 1.6e-21 SMART
Predicted Effect silent
Transcript: ENSMUST00000190410
SMART Domains Protein: ENSMUSP00000140527
Gene: ENSMUSG00000026432

DomainStartEndE-ValueType
Pfam:7tm_1 51 121 8.5e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele display dysregulation of the hypothalamic-pituitary-adrenal axis activity under stress and resting conditions. Homozygous null mice for other alleles display decreased aggression or an increased propensity for seizures. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(4) Targeted, other(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Avpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Avpr1b APN 1 131600147 missense probably damaging 1.00
IGL02516:Avpr1b APN 1 131600629 missense probably damaging 0.98
IGL02708:Avpr1b APN 1 131600651 missense probably damaging 1.00
IGL03122:Avpr1b APN 1 131600519 missense probably damaging 1.00
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0654:Avpr1b UTSW 1 131599742 start codon destroyed probably null 0.98
R0690:Avpr1b UTSW 1 131600281 missense probably damaging 0.99
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1704:Avpr1b UTSW 1 131609504 missense possibly damaging 0.80
R1732:Avpr1b UTSW 1 131600254 missense probably damaging 1.00
R1754:Avpr1b UTSW 1 131600101 missense probably damaging 1.00
R6103:Avpr1b UTSW 1 131609417 missense probably damaging 1.00
R7246:Avpr1b UTSW 1 131600270 missense probably damaging 1.00
R7283:Avpr1b UTSW 1 131609731 missense probably benign 0.26
Z1176:Avpr1b UTSW 1 131609573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGATTCAGCCTCTGTCCTAG -3'
(R):5'- GTAGATGGACCACAGGTGTG -3'

Sequencing Primer
(F):5'- AGTTTGCACGACTAATGGGCC -3'
(R):5'- CACAGGTGTGGGTCAGCAG -3'
Posted On2020-07-28