Incidental Mutation 'R8253:Itih5'
ID 640111
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 067679-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8253 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10243406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 381 (I381T)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: I381T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: I381T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,874,702 (GRCm39) E493G probably benign Het
Akr1a1 A T 4: 116,493,840 (GRCm39) D313E probably damaging Het
Ap1m1 T A 8: 73,006,730 (GRCm39) V242E probably damaging Het
Atad2b T A 12: 5,024,159 (GRCm39) S670T possibly damaging Het
Atad2b C T 12: 5,024,160 (GRCm39) S670L probably benign Het
Atp23 C T 10: 126,704,543 (GRCm39) G197S probably benign Het
Avpr1b A T 1: 131,537,154 (GRCm39) T313S probably benign Het
Cblc A G 7: 19,520,157 (GRCm39) I362T probably damaging Het
Ccdc171 T A 4: 83,661,207 (GRCm39) S1106T probably damaging Het
Cimap3 T C 3: 105,905,683 (GRCm39) M193V probably benign Het
Csde1 C A 3: 102,946,037 (GRCm39) N10K probably damaging Het
Csnk2a2 T C 8: 96,215,005 (GRCm39) Y24C Het
Cyb5r4 G T 9: 86,941,108 (GRCm39) L420F probably damaging Het
Cyth4 A G 15: 78,486,937 (GRCm39) I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dner C T 1: 84,512,598 (GRCm39) G323E probably damaging Het
Elf1 T C 14: 79,773,792 (GRCm39) M1T probably null Het
Fam13c T C 10: 70,389,033 (GRCm39) S520P probably damaging Het
Fhip1b T A 7: 105,028,294 (GRCm39) H885L possibly damaging Het
Gabra2 A G 5: 71,249,413 (GRCm39) I30T probably benign Het
Gm6793 T A 8: 112,741,640 (GRCm39) M1L probably benign Het
Inpp5a T C 7: 139,061,556 (GRCm39) L76P probably damaging Het
Lyrm7 T C 11: 54,741,227 (GRCm39) I36V probably null Het
Magi2 A G 5: 20,814,305 (GRCm39) I906V probably benign Het
Mup5 C T 4: 61,752,811 (GRCm39) A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 (GRCm39) R248W probably damaging Het
Or52z14 A T 7: 103,253,538 (GRCm39) I226L possibly damaging Het
Or5p50 A G 7: 107,421,776 (GRCm39) I300T probably damaging Het
Palm A T 10: 79,643,511 (GRCm39) K80* probably null Het
Pcyox1 C T 6: 86,366,044 (GRCm39) R390K probably benign Het
Pdx1 T C 5: 147,207,459 (GRCm39) probably null Het
Pkp2 T A 16: 16,086,406 (GRCm39) V689D probably damaging Het
Prkar2a G T 9: 108,617,638 (GRCm39) R232L probably damaging Het
Rasgrp4 C T 7: 28,838,287 (GRCm39) T87M possibly damaging Het
Ryr2 T A 13: 11,842,439 (GRCm39) Q486L possibly damaging Het
Shd T C 17: 56,283,295 (GRCm39) V309A Het
Skint7 C T 4: 111,834,675 (GRCm39) Q20* probably null Het
Slc35g1 C A 19: 38,391,237 (GRCm39) T173K probably damaging Het
Slit2 T C 5: 48,433,013 (GRCm39) F1073L probably benign Het
Snx18 T A 13: 113,731,317 (GRCm39) D559V probably damaging Het
Tbr1 G T 2: 61,635,585 (GRCm39) Q178H probably benign Het
Tmem145 T G 7: 25,006,939 (GRCm39) Y114D probably damaging Het
Ttc22 T C 4: 106,495,717 (GRCm39) L357P probably damaging Het
Uba2 T C 7: 33,850,323 (GRCm39) M377V probably damaging Het
Vps13c T A 9: 67,850,770 (GRCm39) Y2242* probably null Het
Xdh T G 17: 74,225,377 (GRCm39) Q475P possibly damaging Het
Zbtb42 T G 12: 112,646,746 (GRCm39) L307R probably damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GCAAACGCTTGTCAGATTCTC -3'
(R):5'- GCAGTTCTCCAGCGAGAGTTTC -3'

Sequencing Primer
(F):5'- GCTTGTCAGATTCTCAAAAAGTCACC -3'
(R):5'- TCCAGCGAGAGTTTCTCTAACAG -3'
Posted On 2020-07-28