Incidental Mutation 'R8253:Tbr1'
ID640112
Institutional Source Beutler Lab
Gene Symbol Tbr1
Ensembl Gene ENSMUSG00000035033
Gene NameT-box brain gene 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location61802930-61814114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 61805241 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 178 (Q178H)
Ref Sequence ENSEMBL: ENSMUSP00000046787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028278] [ENSMUST00000048934] [ENSMUST00000102737]
Predicted Effect probably benign
Transcript: ENSMUST00000028278
SMART Domains Protein: ENSMUSP00000028278
Gene: ENSMUSG00000026914

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
JAB_MPN 30 165 3.71e-49 SMART
Pfam:MitMem_reg 173 307 9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048934
AA Change: Q178H

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: Q178H

DomainStartEndE-ValueType
low complexity region 108 122 N/A INTRINSIC
TBOX 203 398 1.6e-125 SMART
Pfam:T-box_assoc 418 679 9.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102737
SMART Domains Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033

DomainStartEndE-ValueType
TBOX 1 135 5.05e-41 SMART
low complexity region 184 193 N/A INTRINSIC
low complexity region 306 315 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Tbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tbr1 APN 2 61805281 missense probably benign 0.14
IGL01309:Tbr1 APN 2 61806067 missense possibly damaging 0.92
IGL02161:Tbr1 APN 2 61805239 nonsense probably null
IGL02256:Tbr1 APN 2 61804874 missense probably damaging 0.99
IGL02336:Tbr1 APN 2 61804992 missense possibly damaging 0.93
IGL02526:Tbr1 APN 2 61811698 missense probably benign 0.00
FR4340:Tbr1 UTSW 2 61806347 intron probably benign
R0594:Tbr1 UTSW 2 61811620 missense possibly damaging 0.49
R0847:Tbr1 UTSW 2 61805029 missense probably benign 0.00
R1101:Tbr1 UTSW 2 61804739 missense probably benign 0.00
R1247:Tbr1 UTSW 2 61811618 missense possibly damaging 0.78
R1944:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R3080:Tbr1 UTSW 2 61807291 nonsense probably null
R4110:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4111:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4440:Tbr1 UTSW 2 61804838 missense possibly damaging 0.92
R4790:Tbr1 UTSW 2 61811588 missense probably benign 0.04
R4979:Tbr1 UTSW 2 61805249 splice site probably null
R5054:Tbr1 UTSW 2 61806002 missense possibly damaging 0.83
R5283:Tbr1 UTSW 2 61804900 missense probably benign 0.00
R5545:Tbr1 UTSW 2 61807376 missense possibly damaging 0.93
R6178:Tbr1 UTSW 2 61804815 missense possibly damaging 0.91
R6290:Tbr1 UTSW 2 61805050 missense probably benign
R6389:Tbr1 UTSW 2 61806287 start gained probably benign
R6637:Tbr1 UTSW 2 61811630 missense probably benign 0.17
R6983:Tbr1 UTSW 2 61811735 missense probably damaging 1.00
R7021:Tbr1 UTSW 2 61807344 missense probably benign 0.18
R7112:Tbr1 UTSW 2 61811816 missense probably benign 0.02
R7254:Tbr1 UTSW 2 61806042 missense probably damaging 1.00
R7291:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R7438:Tbr1 UTSW 2 61804817 missense possibly damaging 0.92
Z1176:Tbr1 UTSW 2 61812147 missense probably benign
Z1177:Tbr1 UTSW 2 61812231 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCAGATCGTTACCTACTC -3'
(R):5'- CAAGAAAGTAGCATTACCTTCCCTG -3'

Sequencing Primer
(F):5'- GCAGATCGTTACCTACTCTCTCAG -3'
(R):5'- AAGTAGCATTACCTTCCCTGTTTAG -3'
Posted On2020-07-28