Incidental Mutation 'R8253:Csde1'
ID640113
Institutional Source Beutler Lab
Gene Symbol Csde1
Ensembl Gene ENSMUSG00000068823
Gene Namecold shock domain containing E1, RNA binding
Synonymsunr, D3Jfr1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103020426-103058186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103038721 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 10 (N10K)
Ref Sequence ENSEMBL: ENSMUSP00000029446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029446] [ENSMUST00000195889] [ENSMUST00000197488] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199240] [ENSMUST00000199420] [ENSMUST00000199571]
Predicted Effect probably damaging
Transcript: ENSMUST00000029446
AA Change: N10K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823
AA Change: N10K

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195889
SMART Domains Protein: ENSMUSP00000142647
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 58 119 9e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197488
AA Change: N10K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823
AA Change: N10K

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197827
AA Change: N10K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823
AA Change: N10K

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect probably damaging
Transcript: ENSMUST00000198180
AA Change: N10K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823
AA Change: N10K

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199240
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199420
AA Change: N10K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823
AA Change: N10K

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199571
AA Change: N10K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823
AA Change: N10K

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Csde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Csde1 APN 3 103040525 missense possibly damaging 0.80
IGL01419:Csde1 APN 3 103038770 missense probably damaging 1.00
IGL02147:Csde1 APN 3 103039934 missense probably damaging 1.00
IGL02161:Csde1 APN 3 103050338 missense probably damaging 0.99
IGL02442:Csde1 APN 3 103054819 missense probably benign 0.20
IGL03036:Csde1 APN 3 103043839 missense probably damaging 0.99
R0526:Csde1 UTSW 3 103056426 missense possibly damaging 0.76
R0727:Csde1 UTSW 3 103043638 missense probably benign
R1738:Csde1 UTSW 3 103029177 intron probably benign
R1744:Csde1 UTSW 3 103050315 missense probably benign 0.31
R2007:Csde1 UTSW 3 103044791 missense probably damaging 1.00
R4665:Csde1 UTSW 3 103047072 missense probably damaging 1.00
R4806:Csde1 UTSW 3 103056369 unclassified probably benign
R5202:Csde1 UTSW 3 103039934 missense probably damaging 1.00
R5298:Csde1 UTSW 3 103047209 splice site probably null
R5429:Csde1 UTSW 3 103052841 missense possibly damaging 0.75
R5896:Csde1 UTSW 3 103040543 intron probably benign
R6076:Csde1 UTSW 3 103041229 missense possibly damaging 0.82
R6093:Csde1 UTSW 3 103052902 missense probably damaging 1.00
R6118:Csde1 UTSW 3 103054754 missense probably benign 0.45
R6213:Csde1 UTSW 3 103040514 missense probably damaging 1.00
R6263:Csde1 UTSW 3 103040017 missense probably benign 0.05
R6653:Csde1 UTSW 3 103052868 missense probably damaging 1.00
R6894:Csde1 UTSW 3 103044656 missense possibly damaging 0.56
R7155:Csde1 UTSW 3 103039953 missense probably damaging 0.99
R8270:Csde1 UTSW 3 103038755 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCCCTAAGGACTTGAGTGTGTG -3'
(R):5'- GAGCTGACAGATTACCTCCTAC -3'

Sequencing Primer
(F):5'- CCTAAGGACTTGAGTGTGTGTTGTG -3'
(R):5'- CCTACTTTTAAGTCTTGGAGGTTGCC -3'
Posted On2020-07-28