Incidental Mutation 'R8253:Mup5'
ID640116
Institutional Source Beutler Lab
Gene Symbol Mup5
Ensembl Gene ENSMUSG00000058523
Gene Namemajor urinary protein 5
SynonymsMup V
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R8253 (G1)
Quality Score201.009
Status Not validated
Chromosome4
Chromosomal Location61831319-61835233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61834574 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 71 (A71T)
Ref Sequence ENSEMBL: ENSMUSP00000080908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082287]
Predicted Effect probably benign
Transcript: ENSMUST00000082287
AA Change: A71T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080908
Gene: ENSMUSG00000058523
AA Change: A71T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Lipocalin 34 173 8.3e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Mup5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0167:Mup5 UTSW 4 61833782 critical splice acceptor site probably null
R0485:Mup5 UTSW 4 61832992 splice site probably null
R0547:Mup5 UTSW 4 61833000 missense probably damaging 1.00
R1054:Mup5 UTSW 4 61832634 missense probably benign 0.07
R1597:Mup5 UTSW 4 61835080 missense possibly damaging 0.87
R1721:Mup5 UTSW 4 61832370 nonsense probably null
R1772:Mup5 UTSW 4 61832341 critical splice donor site probably null
R1881:Mup5 UTSW 4 61834631 nonsense probably null
R2104:Mup5 UTSW 4 61833725 missense probably damaging 0.99
R2384:Mup5 UTSW 4 61835024 splice site probably null
R4971:Mup5 UTSW 4 61833060 missense probably benign 0.32
R5246:Mup5 UTSW 4 61834637 missense probably benign 0.04
R5926:Mup5 UTSW 4 61833049 missense probably benign 0.03
R6905:Mup5 UTSW 4 61833103 missense possibly damaging 0.60
R6912:Mup5 UTSW 4 61834569 missense probably benign 0.03
R6957:Mup5 UTSW 4 61833036 missense probably damaging 1.00
R7204:Mup5 UTSW 4 61833755 missense probably damaging 0.96
R7224:Mup5 UTSW 4 61832385 missense probably damaging 1.00
R7244:Mup5 UTSW 4 61831581 splice site probably null
R7570:Mup5 UTSW 4 61834674 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGGTTCAGTGTCACATGGAGC -3'
(R):5'- TGTATGCTCAGGCCCTAACC -3'

Sequencing Primer
(F):5'- CAGTGTCACATGGAGCATTCTAG -3'
(R):5'- TTCAAGTGGAAACCTGTGCATG -3'
Posted On2020-07-28