Incidental Mutation 'R8253:Ttc22'
ID640118
Institutional Source Beutler Lab
Gene Symbol Ttc22
Ensembl Gene ENSMUSG00000034919
Gene Nametetratricopeptide repeat domain 22
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location106622432-106640189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106638520 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 357 (L357P)
Ref Sequence ENSEMBL: ENSMUSP00000035773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047922]
Predicted Effect probably damaging
Transcript: ENSMUST00000047922
AA Change: L357P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035773
Gene: ENSMUSG00000034919
AA Change: L357P

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
TPR 66 99 2.3e1 SMART
Pfam:TPR_8 100 128 2.5e-3 PFAM
TPR 295 328 2.99e1 SMART
TPR 432 465 6.19e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136505
Meta Mutation Damage Score 0.1824 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with seven tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Ttc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Ttc22 APN 4 106638576 missense probably damaging 1.00
IGL01749:Ttc22 APN 4 106638603 missense probably benign 0.04
IGL02189:Ttc22 APN 4 106639157 missense probably benign 0.21
IGL02206:Ttc22 APN 4 106635989 missense probably damaging 1.00
IGL02219:Ttc22 APN 4 106638490 missense probably damaging 0.97
IGL02348:Ttc22 APN 4 106622938 missense probably damaging 1.00
IGL02754:Ttc22 APN 4 106638472 missense probably benign 0.22
IGL02982:Ttc22 APN 4 106638586 missense probably damaging 0.97
R0044:Ttc22 UTSW 4 106636806 missense probably benign
R0607:Ttc22 UTSW 4 106639313 missense possibly damaging 0.72
R0611:Ttc22 UTSW 4 106634184 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1584:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1654:Ttc22 UTSW 4 106634211 missense probably damaging 1.00
R1776:Ttc22 UTSW 4 106639040 missense possibly damaging 0.64
R1864:Ttc22 UTSW 4 106636806 missense probably benign
R1886:Ttc22 UTSW 4 106636866 critical splice donor site probably null
R2136:Ttc22 UTSW 4 106622672 missense possibly damaging 0.49
R2156:Ttc22 UTSW 4 106639040 missense probably benign 0.43
R2267:Ttc22 UTSW 4 106639085 missense possibly damaging 0.60
R2698:Ttc22 UTSW 4 106639238 missense probably benign
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3754:Ttc22 UTSW 4 106639081 missense probably damaging 0.99
R5399:Ttc22 UTSW 4 106636757 missense probably damaging 1.00
R5839:Ttc22 UTSW 4 106638520 missense probably damaging 0.99
R6156:Ttc22 UTSW 4 106638583 missense probably benign 0.00
R6678:Ttc22 UTSW 4 106623045 missense probably benign 0.17
R6912:Ttc22 UTSW 4 106638603 missense probably benign 0.04
R7094:Ttc22 UTSW 4 106635907 nonsense probably null
R8166:Ttc22 UTSW 4 106634476 missense probably damaging 0.99
Z1177:Ttc22 UTSW 4 106622523 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTTTCTGCAGCCAAACAGG -3'
(R):5'- TCATTACATCCATTCCACAGGG -3'

Sequencing Primer
(F):5'- AGGATGTCCCTGGTTGCTTGC -3'
(R):5'- CACTGGAGGAGGCAGGC -3'
Posted On2020-07-28