Incidental Mutation 'R8253:Skint7'
ID640119
Institutional Source Beutler Lab
Gene Symbol Skint7
Ensembl Gene ENSMUSG00000049214
Gene Nameselection and upkeep of intraepithelial T cells 7
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location111972923-111988223 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 111977478 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 20 (Q20*)
Ref Sequence ENSEMBL: ENSMUSP00000127347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055014] [ENSMUST00000106568] [ENSMUST00000163281]
Predicted Effect probably null
Transcript: ENSMUST00000055014
AA Change: Q20*
SMART Domains Protein: ENSMUSP00000054822
Gene: ENSMUSG00000049214
AA Change: Q20*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106568
AA Change: Q20*
SMART Domains Protein: ENSMUSP00000102178
Gene: ENSMUSG00000049214
AA Change: Q20*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163281
AA Change: Q20*
SMART Domains Protein: ENSMUSP00000127347
Gene: ENSMUSG00000049214
AA Change: Q20*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Skint7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Skint7 APN 4 111982205 missense probably damaging 1.00
IGL01697:Skint7 APN 4 111980457 splice site probably benign
IGL01961:Skint7 APN 4 111977463 missense probably benign 0.01
IGL02232:Skint7 APN 4 111982028 missense possibly damaging 0.70
IGL02675:Skint7 APN 4 111981981 missense probably benign 0.03
IGL02729:Skint7 APN 4 111982170 missense probably benign 0.01
IGL02887:Skint7 APN 4 111982178 missense possibly damaging 0.70
Fraction UTSW 4 111980178 missense probably damaging 0.99
ratio UTSW 4 111984876 splice site probably null
R0315:Skint7 UTSW 4 111988118 missense possibly damaging 0.61
R0401:Skint7 UTSW 4 111980362 missense probably damaging 0.96
R0545:Skint7 UTSW 4 111980198 missense probably benign 0.08
R0607:Skint7 UTSW 4 111977459 nonsense probably null
R0685:Skint7 UTSW 4 111980345 missense possibly damaging 0.71
R1130:Skint7 UTSW 4 111984158 missense probably benign 0.23
R1340:Skint7 UTSW 4 111980219 missense probably damaging 1.00
R1350:Skint7 UTSW 4 111980324 missense possibly damaging 0.78
R1764:Skint7 UTSW 4 111982073 missense probably benign 0.00
R1804:Skint7 UTSW 4 111982012 missense probably damaging 1.00
R2005:Skint7 UTSW 4 111984850 missense probably benign 0.13
R2084:Skint7 UTSW 4 111980178 missense probably damaging 0.99
R4651:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R4652:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R5070:Skint7 UTSW 4 111984134 missense probably damaging 1.00
R5088:Skint7 UTSW 4 111980430 missense possibly damaging 0.78
R5096:Skint7 UTSW 4 111981955 missense probably damaging 0.98
R5311:Skint7 UTSW 4 111980304 missense probably damaging 0.99
R5524:Skint7 UTSW 4 111980349 missense probably damaging 1.00
R5777:Skint7 UTSW 4 111988092 missense probably benign 0.29
R6208:Skint7 UTSW 4 111984876 splice site probably null
R6369:Skint7 UTSW 4 111980293 missense probably benign 0.16
R6752:Skint7 UTSW 4 111980266 missense probably benign 0.21
R7396:Skint7 UTSW 4 111988127 missense probably benign
R7633:Skint7 UTSW 4 111984140 missense probably benign 0.27
R7840:Skint7 UTSW 4 111982226 missense probably benign
R8054:Skint7 UTSW 4 111982229 missense probably benign
Z1176:Skint7 UTSW 4 111980129 missense probably benign 0.01
Z1177:Skint7 UTSW 4 111980235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTCCTGATCAGAATGATGTATC -3'
(R):5'- TTGCTTAGAAGAAGGGATTTAGCAG -3'

Sequencing Primer
(F):5'- TTCTCTCAAATACGGGAAAGCCTTAC -3'
(R):5'- TTTAGCAGAAGAAAGGGTGTGTGAAC -3'
Posted On2020-07-28