Incidental Mutation 'R8253:Akr1a1'
ID640120
Institutional Source Beutler Lab
Gene Symbol Akr1a1
Ensembl Gene ENSMUSG00000028692
Gene Namealdo-keto reductase family 1, member A1 (aldehyde reductase)
SynonymsAkr1a4, 2610201A18Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location116636510-116651680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116636643 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 313 (D313E)
Ref Sequence ENSEMBL: ENSMUSP00000030455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030455] [ENSMUST00000128059]
PDB Structure
High resolution structure of mouse aldehyde reductase (AKR1a4) in its apo-form [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030455
AA Change: D313E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030455
Gene: ENSMUSG00000028692
AA Change: D313E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 294 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128059
SMART Domains Protein: ENSMUSP00000114861
Gene: ENSMUSG00000028692

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 204 3.7e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased osteoporosis in response to pregnancy or castration in the absence of dietary ascorbate. Mice homozygous for a knock-out allele exhibit reduced asorbic acid levels and DL-glyceraldehyde, glucuronolactone and glucuronate reductase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Akr1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Akr1a1 APN 4 116637983 missense probably damaging 1.00
IGL03176:Akr1a1 APN 4 116639075 missense probably damaging 1.00
IGL03265:Akr1a1 APN 4 116637817 missense probably benign 0.42
R0480:Akr1a1 UTSW 4 116639847 missense possibly damaging 0.84
R0972:Akr1a1 UTSW 4 116640007 critical splice acceptor site probably null
R1649:Akr1a1 UTSW 4 116638020 missense probably damaging 1.00
R1711:Akr1a1 UTSW 4 116637974 critical splice donor site probably null
R1727:Akr1a1 UTSW 4 116641051 missense probably damaging 1.00
R1822:Akr1a1 UTSW 4 116636653 missense probably benign 0.13
R4653:Akr1a1 UTSW 4 116637959 unclassified probably benign
R5377:Akr1a1 UTSW 4 116639895 missense probably damaging 1.00
R7386:Akr1a1 UTSW 4 116641054 missense probably damaging 0.98
R7458:Akr1a1 UTSW 4 116637817 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGGACAATTTCGTCTCATGCC -3'
(R):5'- CAGATCTGGGCACATTATTCTAGC -3'

Sequencing Primer
(F):5'- GACAATTTCGTCTCATGCCTAACCAG -3'
(R):5'- GGGCACATTATTCTAGCTAGCCTG -3'
Posted On2020-07-28