Incidental Mutation 'R8253:Gabra2'
ID640123
Institutional Source Beutler Lab
Gene Symbol Gabra2
Ensembl Gene ENSMUSG00000000560
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 2
SynonymsC630048P16Rik, Gabra-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location70957597-71095849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71092070 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 30 (I30T)
Ref Sequence ENSEMBL: ENSMUSP00000142892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000572] [ENSMUST00000197284] [ENSMUST00000198625]
Predicted Effect probably damaging
Transcript: ENSMUST00000000572
AA Change: I30T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000572
Gene: ENSMUSG00000000560
AA Change: I30T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 1.9e-51 PFAM
Pfam:Neur_chan_memb 257 344 1.2e-32 PFAM
low complexity region 364 375 N/A INTRINSIC
low complexity region 392 410 N/A INTRINSIC
transmembrane domain 423 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197284
AA Change: I30T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142892
Gene: ENSMUSG00000000560
AA Change: I30T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 2.7e-53 PFAM
Pfam:Neur_chan_memb 257 354 5.6e-38 PFAM
Pfam:Neur_chan_memb 343 437 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198625
AA Change: I30T

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143645
Gene: ENSMUSG00000000560
AA Change: I30T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
SCOP:d1i9ba_ 47 87 7e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knockout allele are resistant to the anxiolytic effects of diazepam (DZP). Mice homozygous for a different knock-out allele exhibit reduced DZP-induced antihyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Gabra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Gabra2 APN 5 70962072 missense probably benign
IGL01084:Gabra2 APN 5 71006233 missense probably damaging 1.00
IGL01948:Gabra2 APN 5 70961885 missense probably damaging 1.00
IGL01965:Gabra2 APN 5 71008075 splice site probably benign
IGL03263:Gabra2 APN 5 70973493 missense probably damaging 1.00
R0005:Gabra2 UTSW 5 70973436 missense probably benign 0.00
R0751:Gabra2 UTSW 5 71092099 splice site probably benign
R1025:Gabra2 UTSW 5 70973595 missense probably damaging 1.00
R1713:Gabra2 UTSW 5 71014563 missense probably benign 0.24
R1964:Gabra2 UTSW 5 71014450 missense possibly damaging 0.91
R3861:Gabra2 UTSW 5 70973543 missense probably damaging 1.00
R4190:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R4192:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R4193:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R6281:Gabra2 UTSW 5 71034762 missense probably damaging 1.00
R6419:Gabra2 UTSW 5 70962083 missense probably benign 0.00
R6814:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R6872:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R7922:Gabra2 UTSW 5 71007972 nonsense probably null
Z1177:Gabra2 UTSW 5 71007992 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATAGAGTGCATTAAGATGAGCACC -3'
(R):5'- TGAAACAGAATACTTACCTTCCCAG -3'

Sequencing Primer
(F):5'- GAGTGCATTAAGATGAGCACCTTACC -3'
(R):5'- ACCTTCCCAGCAAGTTTAGTG -3'
Posted On2020-07-28