Incidental Mutation 'R8253:Pcyox1'
ID640125
Institutional Source Beutler Lab
Gene Symbol Pcyox1
Ensembl Gene ENSMUSG00000029998
Gene Nameprenylcysteine oxidase 1
Synonyms1200015P13Rik, Pcly, PCL1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location86386006-86397154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86389062 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 390 (R390K)
Ref Sequence ENSEMBL: ENSMUSP00000032065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032065] [ENSMUST00000153723] [ENSMUST00000204116]
Predicted Effect probably benign
Transcript: ENSMUST00000032065
AA Change: R390K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032065
Gene: ENSMUSG00000029998
AA Change: R390K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 8.2e-13 PFAM
Pfam:Amino_oxidase 44 346 7.1e-9 PFAM
Pfam:Prenylcys_lyase 128 501 8.1e-157 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122602
Gene: ENSMUSG00000029998
AA Change: R172K

DomainStartEndE-ValueType
Pfam:Prenylcys_lyase 1 73 6.1e-25 PFAM
Pfam:Prenylcys_lyase 69 197 7.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153723
SMART Domains Protein: ENSMUSP00000119449
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Prenylcys_lyase 59 181 5.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204116
SMART Domains Protein: ENSMUSP00000145474
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 4.9e-12 PFAM
Pfam:Amino_oxidase 44 136 3.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product (Tschantz et al., 1999 [PubMed 10585463]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious pathology despite a striking accumulation of both farnesylcysteine and geranylgeranylcysteine in brain and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Pcyox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Pcyox1 APN 6 86388753 missense probably damaging 1.00
IGL02008:Pcyox1 APN 6 86392268 missense probably benign 0.01
IGL02655:Pcyox1 APN 6 86389344 missense probably damaging 1.00
R0690:Pcyox1 UTSW 6 86394442 missense probably damaging 1.00
R4631:Pcyox1 UTSW 6 86389143 missense probably benign 0.00
R4631:Pcyox1 UTSW 6 86389230 missense possibly damaging 0.96
R4976:Pcyox1 UTSW 6 86388726 missense probably damaging 1.00
R5227:Pcyox1 UTSW 6 86391744 missense probably damaging 0.98
R5288:Pcyox1 UTSW 6 86392354 splice site probably null
R5408:Pcyox1 UTSW 6 86392298 missense probably damaging 1.00
R5862:Pcyox1 UTSW 6 86391674 critical splice donor site probably null
R6002:Pcyox1 UTSW 6 86392182 missense probably benign 0.02
R6123:Pcyox1 UTSW 6 86388928 missense possibly damaging 0.88
R6290:Pcyox1 UTSW 6 86388899 missense probably benign 0.24
R6766:Pcyox1 UTSW 6 86394408 critical splice donor site probably null
R7047:Pcyox1 UTSW 6 86388909 missense probably damaging 1.00
R7066:Pcyox1 UTSW 6 86394496 missense probably damaging 1.00
R7139:Pcyox1 UTSW 6 86394537 missense possibly damaging 0.50
R7268:Pcyox1 UTSW 6 86391731 missense possibly damaging 0.69
R7445:Pcyox1 UTSW 6 86391679 missense possibly damaging 0.83
R7870:Pcyox1 UTSW 6 86392341 missense probably damaging 1.00
R8050:Pcyox1 UTSW 6 86389146 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCCATTGAGGTAATAGAGCCG -3'
(R):5'- TTCCGAAATTTTGATCCGCC -3'

Sequencing Primer
(F):5'- ATTGAGGTAATAGAGCCGGTCGTG -3'
(R):5'- GAAATTTTGATCCGCCCATCGAGG -3'
Posted On2020-07-28