Incidental Mutation 'R8253:Tmem145'
ID640127
Institutional Source Beutler Lab
Gene Symbol Tmem145
Ensembl Gene ENSMUSG00000043843
Gene Nametransmembrane protein 145
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25306106-25316195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25307514 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 114 (Y114D)
Ref Sequence ENSEMBL: ENSMUSP00000104046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080288] [ENSMUST00000108409] [ENSMUST00000119703]
Predicted Effect probably benign
Transcript: ENSMUST00000080288
SMART Domains Protein: ENSMUSP00000104047
Gene: ENSMUSG00000058741

DomainStartEndE-ValueType
Pfam:Pro-rich_19 1 366 3.3e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108409
AA Change: Y114D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104046
Gene: ENSMUSG00000043843
AA Change: Y114D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 157 411 7.5e-81 PFAM
low complexity region 486 503 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119703
AA Change: Y114D

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112676
Gene: ENSMUSG00000043843
AA Change: Y114D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 143 397 4.3e-81 PFAM
low complexity region 478 493 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Tmem145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tmem145 APN 7 25314730 missense possibly damaging 0.88
IGL00958:Tmem145 APN 7 25307357 critical splice donor site probably null
IGL01347:Tmem145 APN 7 25314835 missense probably damaging 0.97
IGL01936:Tmem145 APN 7 25311391 missense probably damaging 0.97
IGL02526:Tmem145 APN 7 25308232 missense probably benign 0.20
IGL02686:Tmem145 APN 7 25314725 missense probably damaging 1.00
IGL03182:Tmem145 APN 7 25314879 missense probably damaging 1.00
R0087:Tmem145 UTSW 7 25307843 missense probably damaging 1.00
R0180:Tmem145 UTSW 7 25314699 missense probably benign 0.05
R0329:Tmem145 UTSW 7 25308674 splice site probably benign
R0504:Tmem145 UTSW 7 25311362 missense probably damaging 1.00
R1488:Tmem145 UTSW 7 25307435 splice site probably null
R1681:Tmem145 UTSW 7 25314734 missense possibly damaging 0.95
R2352:Tmem145 UTSW 7 25306173 missense probably benign
R3834:Tmem145 UTSW 7 25311361 missense probably damaging 1.00
R4175:Tmem145 UTSW 7 25308793 missense probably benign 0.04
R4414:Tmem145 UTSW 7 25307129 missense probably damaging 1.00
R4485:Tmem145 UTSW 7 25307162 missense possibly damaging 0.76
R4631:Tmem145 UTSW 7 25307825 missense probably benign 0.00
R4983:Tmem145 UTSW 7 25308602 missense probably benign 0.03
R4999:Tmem145 UTSW 7 25309034 missense probably benign 0.04
R5772:Tmem145 UTSW 7 25315614 missense probably benign 0.21
R5821:Tmem145 UTSW 7 25315521 missense probably benign 0.30
R5909:Tmem145 UTSW 7 25308193 missense possibly damaging 0.89
R6021:Tmem145 UTSW 7 25308845 splice site probably null
R6430:Tmem145 UTSW 7 25309038 missense possibly damaging 0.84
R6768:Tmem145 UTSW 7 25308636 missense probably damaging 1.00
R6778:Tmem145 UTSW 7 25311376 missense probably benign 0.04
R7428:Tmem145 UTSW 7 25307165 critical splice donor site probably null
R7536:Tmem145 UTSW 7 25307869 missense probably damaging 1.00
R7748:Tmem145 UTSW 7 25307328 nonsense probably null
R7826:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
R8441:Tmem145 UTSW 7 25308775 missense possibly damaging 0.62
Z1177:Tmem145 UTSW 7 25309646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACGACCCATCCCAGTG -3'
(R):5'- GCTGAGTGCGATATACCACCATC -3'

Sequencing Primer
(F):5'- TGGCCAGCGGTGTACAAG -3'
(R):5'- GAGTGCGATATACCACCATCTTTCAC -3'
Posted On2020-07-28