Incidental Mutation 'R8253:Rasgrp4'
ID640128
Institutional Source Beutler Lab
Gene Symbol Rasgrp4
Ensembl Gene ENSMUSG00000030589
Gene NameRAS guanyl releasing protein 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29134851-29153961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29138862 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 87 (T87M)
Ref Sequence ENSEMBL: ENSMUSP00000125137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000161522] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032811
AA Change: T87M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094617
AA Change: T87M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159351
AA Change: T87M

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159975
AA Change: T87M

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160194
AA Change: T87M

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161522
AA Change: T87M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203070
AA Change: T87M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
AA Change: T87M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
AA Change: T87M

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
AA Change: T87M

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
AA Change: T87M

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589
AA Change: T87M

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Rasgrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rasgrp4 APN 7 29148541 splice site probably benign
IGL01145:Rasgrp4 APN 7 29151473 missense possibly damaging 0.83
IGL01806:Rasgrp4 APN 7 29139050 missense possibly damaging 0.83
IGL02023:Rasgrp4 APN 7 29138910 missense probably damaging 1.00
IGL02499:Rasgrp4 APN 7 29151503 utr 3 prime probably benign
IGL02989:Rasgrp4 APN 7 29148406 missense probably damaging 1.00
IGL03281:Rasgrp4 APN 7 29146025 missense possibly damaging 0.69
R0092:Rasgrp4 UTSW 7 29145132 missense possibly damaging 0.74
R0390:Rasgrp4 UTSW 7 29145860 missense probably damaging 1.00
R0614:Rasgrp4 UTSW 7 29145851 missense probably damaging 1.00
R0628:Rasgrp4 UTSW 7 29140210 intron probably benign
R1420:Rasgrp4 UTSW 7 29140345 missense probably damaging 0.98
R1434:Rasgrp4 UTSW 7 29137727 critical splice donor site probably null
R1664:Rasgrp4 UTSW 7 29140263 missense probably benign 0.00
R1911:Rasgrp4 UTSW 7 29138877 missense probably damaging 1.00
R2164:Rasgrp4 UTSW 7 29139045 missense probably damaging 1.00
R4277:Rasgrp4 UTSW 7 29152594 unclassified probably benign
R5024:Rasgrp4 UTSW 7 29148407 missense probably damaging 1.00
R5423:Rasgrp4 UTSW 7 29145136 missense probably damaging 1.00
R5813:Rasgrp4 UTSW 7 29145214 missense probably damaging 1.00
R5823:Rasgrp4 UTSW 7 29137717 missense probably benign 0.00
R6268:Rasgrp4 UTSW 7 29143068 missense probably damaging 1.00
R6285:Rasgrp4 UTSW 7 29148383 missense probably damaging 1.00
R7062:Rasgrp4 UTSW 7 29150194 missense possibly damaging 0.92
R7269:Rasgrp4 UTSW 7 29148430 missense probably damaging 1.00
R7471:Rasgrp4 UTSW 7 29145980 missense probably damaging 1.00
R7535:Rasgrp4 UTSW 7 29139059 missense probably benign
R7792:Rasgrp4 UTSW 7 29143102 missense probably damaging 1.00
R7854:Rasgrp4 UTSW 7 29150610 missense unknown
R7855:Rasgrp4 UTSW 7 29150610 missense unknown
R8052:Rasgrp4 UTSW 7 29149937 missense probably damaging 1.00
R8144:Rasgrp4 UTSW 7 29149117 missense probably damaging 1.00
R8256:Rasgrp4 UTSW 7 29143075 missense probably damaging 1.00
Z1088:Rasgrp4 UTSW 7 29150536 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTCATGCCATCCCATGCAC -3'
(R):5'- TCTAGTCAAGGCTGTTTACCAG -3'

Sequencing Primer
(F):5'- GAGGAAATCATGTTGCTTACCC -3'
(R):5'- GTTTACCAGCACTCCCATTCG -3'
Posted On2020-07-28