Incidental Mutation 'R8253:Olfr619'
ID640130
Institutional Source Beutler Lab
Gene Symbol Olfr619
Ensembl Gene ENSMUSG00000073944
Gene Nameolfactory receptor 619
SynonymsMOR31-5, GA_x6K02T2PBJ9-6326488-6327450
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103600575-103604859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103604331 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 226 (I226L)
Ref Sequence ENSEMBL: ENSMUSP00000095798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098196]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098196
AA Change: I226L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095798
Gene: ENSMUSG00000073944
AA Change: I226L

DomainStartEndE-ValueType
Pfam:7tm_4 36 316 4.4e-106 PFAM
Pfam:7TM_GPCR_Srsx 40 265 5e-10 PFAM
Pfam:7tm_1 46 298 3.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Olfr619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Olfr619 APN 7 103604067 missense probably benign 0.23
IGL01806:Olfr619 APN 7 103604341 missense probably benign 0.21
IGL01934:Olfr619 APN 7 103603975 missense probably damaging 1.00
IGL02269:Olfr619 APN 7 103603882 missense probably damaging 0.98
IGL03049:Olfr619 APN 7 103604091 missense probably damaging 0.99
IGL03165:Olfr619 APN 7 103604011 missense probably damaging 0.98
IGL03338:Olfr619 APN 7 103604408 nonsense probably null
R1378:Olfr619 UTSW 7 103603938 nonsense probably null
R1660:Olfr619 UTSW 7 103603675 nonsense probably null
R1975:Olfr619 UTSW 7 103604012 splice site probably null
R1985:Olfr619 UTSW 7 103603672 missense probably benign
R2249:Olfr619 UTSW 7 103603736 missense probably benign 0.00
R2423:Olfr619 UTSW 7 103604034 missense probably benign 0.14
R4005:Olfr619 UTSW 7 103604263 missense probably damaging 1.00
R4931:Olfr619 UTSW 7 103604374 missense probably benign 0.01
R4939:Olfr619 UTSW 7 103604251 missense probably benign 0.12
R4942:Olfr619 UTSW 7 103604194 missense probably benign
R4970:Olfr619 UTSW 7 103603990 missense probably damaging 0.98
R4993:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
R5254:Olfr619 UTSW 7 103603789 missense probably benign 0.19
R6001:Olfr619 UTSW 7 103603972 missense probably damaging 1.00
R6905:Olfr619 UTSW 7 103604367 missense probably benign
R6985:Olfr619 UTSW 7 103603668 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATGGGCATTGCAGCTGTG -3'
(R):5'- TGAACAACTCTCTCCTGAATTTGC -3'

Sequencing Primer
(F):5'- GCATTGCAGCTGTGACTAGAAG -3'
(R):5'- GCTTGGTCTTTACTCCATAAATGATG -3'
Posted On2020-07-28