Incidental Mutation 'R8253:Inpp5a'
ID640133
Institutional Source Beutler Lab
Gene Symbol Inpp5a
Ensembl Gene ENSMUSG00000025477
Gene Nameinositol polyphosphate-5-phosphatase A
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139389109-139579652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139481640 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 76 (L76P)
Ref Sequence ENSEMBL: ENSMUSP00000026550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026550] [ENSMUST00000097975] [ENSMUST00000106098]
Predicted Effect probably damaging
Transcript: ENSMUST00000026550
AA Change: L76P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026550
Gene: ENSMUSG00000025477
AA Change: L76P

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
low complexity region 415 422 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097975
AA Change: L84P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095589
Gene: ENSMUSG00000025477
AA Change: L84P

DomainStartEndE-ValueType
IPPc 25 408 1.84e-150 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106098
AA Change: L76P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101704
Gene: ENSMUSG00000025477
AA Change: L76P

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-associated type I inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a gene trapped allele show preweaning lethality, while surviving mice exhibit decreased body size, small cerebellum, and early-onset, slowly progressive Purkinje cell degeneration, gliosis, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Inpp5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Inpp5a APN 7 139516721 missense probably benign 0.00
IGL01354:Inpp5a APN 7 139538234 missense probably damaging 0.99
IGL01734:Inpp5a APN 7 139454090 missense possibly damaging 0.92
IGL02536:Inpp5a APN 7 139567422 missense probably benign 0.17
IGL03023:Inpp5a APN 7 139525786 splice site probably null
IGL03390:Inpp5a APN 7 139525748 missense probably benign 0.01
Anza UTSW 7 139525738 missense probably damaging 1.00
borrego UTSW 7 139525670 missense probably damaging 1.00
Joshua_tree UTSW 7 139574982 missense probably damaging 1.00
PIT4402001:Inpp5a UTSW 7 139511453 missense probably benign 0.02
R0724:Inpp5a UTSW 7 139516663 missense probably benign 0.08
R0940:Inpp5a UTSW 7 139525738 missense probably damaging 1.00
R1258:Inpp5a UTSW 7 139525744 missense probably damaging 1.00
R2112:Inpp5a UTSW 7 139574961 missense probably damaging 0.99
R2328:Inpp5a UTSW 7 139478094 nonsense probably null
R4223:Inpp5a UTSW 7 139558905 missense possibly damaging 0.72
R4307:Inpp5a UTSW 7 139574963 missense possibly damaging 0.87
R4703:Inpp5a UTSW 7 139558923 missense probably damaging 1.00
R4781:Inpp5a UTSW 7 139478005 missense probably benign 0.11
R4997:Inpp5a UTSW 7 139400738 missense probably benign 0.07
R5762:Inpp5a UTSW 7 139538181 missense possibly damaging 0.95
R6014:Inpp5a UTSW 7 139574982 missense probably damaging 1.00
R6381:Inpp5a UTSW 7 139400673 missense probably benign 0.00
R7255:Inpp5a UTSW 7 139511448 missense probably damaging 0.96
R7324:Inpp5a UTSW 7 139525670 missense probably damaging 1.00
R7362:Inpp5a UTSW 7 139578380 missense probably benign 0.00
R7561:Inpp5a UTSW 7 139567422 missense probably damaging 0.99
R7748:Inpp5a UTSW 7 139574995 missense probably damaging 0.96
R8178:Inpp5a UTSW 7 139538237 missense probably damaging 1.00
Z1177:Inpp5a UTSW 7 139525775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTATGCCAAGGACACAAAG -3'
(R):5'- TGCGTGCCGACTTAGTACTC -3'

Sequencing Primer
(F):5'- GAGTCCACTGTGGCTATCACTG -3'
(R):5'- CCGACTTAGTACTCTTTGGAGACAG -3'
Posted On2020-07-28