Incidental Mutation 'R8253:Ap1m1'
ID640134
Institutional Source Beutler Lab
Gene Symbol Ap1m1
Ensembl Gene ENSMUSG00000003033
Gene Nameadaptor-related protein complex AP-1, mu subunit 1
Synonymsmu1A, [m]1A, Cltnm, AP47, Adtm1A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location72240018-72257385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72252886 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 242 (V242E)
Ref Sequence ENSEMBL: ENSMUSP00000003117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003117] [ENSMUST00000126885] [ENSMUST00000145213] [ENSMUST00000212708] [ENSMUST00000212841] [ENSMUST00000212940]
PDB Structure
AP1 CLATHRIN ADAPTOR CORE [X-RAY DIFFRACTION]
HIV-1 Nef in complex with MHC-I cytoplasmic domain and Mu1 adaptin subunit of AP1 adaptor (second domain) [X-RAY DIFFRACTION]
HIV-1 Nef in complex with MHC-I cytoplasmic domain and Mu1 adaptin subunit of AP1 adaptor (second domain) [X-RAY DIFFRACTION]
Structural basis for recruitment and activation of the AP-1 clathrin adaptor complex by Arf1 [X-RAY DIFFRACTION]
Crystal structure of the human BST2 cytoplasmic domain and the HIV-1 Vpu cytoplasmic domain bound to the clathrin adaptor protein complex 1 (AP1) core [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003117
AA Change: V242E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003117
Gene: ENSMUSG00000003033
AA Change: V242E

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 4.6e-7 PFAM
Pfam:Adap_comp_sub 157 422 2.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126885
SMART Domains Protein: ENSMUSP00000120435
Gene: ENSMUSG00000003033

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 4 115 4.8e-7 PFAM
Pfam:Adap_comp_sub 131 181 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145213
SMART Domains Protein: ENSMUSP00000138319
Gene: ENSMUSG00000003033

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 3 107 7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212708
Predicted Effect probably benign
Transcript: ENSMUST00000212841
Predicted Effect probably benign
Transcript: ENSMUST00000212940
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu-1 subunit of the scaffolding adapter protein complex AP-1 and is a member of the mu adaptin family. The AP-1 complex, which consists of 4 subunits (mu-adaptin, beta-prime adaptin, gamma-adaptin, and the small chain adaptin), is one of the predominant coat proteins of membrane vesicles involved in eukaryotic post-Golgi trafficking. The AP-1 complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. AP-1 complex subunit mu-1 and other mu-adaptins select cargo proteins bearing sequence-specific sorting motifs. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E13.5. Homozygous embryos display hemorrhage of the ventricles and spinal canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Ap1m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ap1m1 APN 8 72255755 missense possibly damaging 0.53
IGL00795:Ap1m1 APN 8 72253509 missense probably damaging 1.00
IGL02165:Ap1m1 APN 8 72249809 missense probably benign 0.41
R0363:Ap1m1 UTSW 8 72252894 missense probably benign 0.22
R0363:Ap1m1 UTSW 8 72256724 unclassified probably benign
R1295:Ap1m1 UTSW 8 72251875 splice site probably null
R1681:Ap1m1 UTSW 8 72256122 missense possibly damaging 0.95
R1784:Ap1m1 UTSW 8 72252849 missense probably benign 0.01
R1934:Ap1m1 UTSW 8 72255793 missense probably damaging 1.00
R4549:Ap1m1 UTSW 8 72240220 missense probably damaging 1.00
R4654:Ap1m1 UTSW 8 72252873 missense possibly damaging 0.94
R6003:Ap1m1 UTSW 8 72249167 missense probably damaging 1.00
R7048:Ap1m1 UTSW 8 72249798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTAGGCAAGCATGTGATGG -3'
(R):5'- TGCCAGTAGAGGGTGATGAC -3'

Sequencing Primer
(F):5'- CATGTGATGGAAGGAGGTGAC -3'
(R):5'- TGGTCAAGGTTTCAGCCCACATAG -3'
Posted On2020-07-28