Incidental Mutation 'R0094:Pigs'
ID64014
Institutional Source Beutler Lab
Gene Symbol Pigs
Ensembl Gene ENSMUSG00000041958
Gene Namephosphatidylinositol glycan anchor biosynthesis, class S
SynonymsLOC245087, LOC276846
MMRRC Submission 038380-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R0094 (G1)
Quality Score85
Status Not validated
Chromosome11
Chromosomal Location78328415-78342782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78340038 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 370 (N370K)
Ref Sequence ENSEMBL: ENSMUSP00000044871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000048073] [ENSMUST00000108295]
Predicted Effect probably benign
Transcript: ENSMUST00000002127
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048073
AA Change: N370K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044871
Gene: ENSMUSG00000041958
AA Change: N370K

DomainStartEndE-ValueType
Pfam:PIG-S 22 547 3.3e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108295
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154700
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,306,886 T185S possibly damaging Het
Amotl1 A G 9: 14,575,387 S441P probably benign Het
Ap5z1 G A 5: 142,476,812 V626M probably benign Het
Cacna2d3 C T 14: 29,170,503 probably null Het
Cfap77 A T 2: 28,984,434 V128D probably damaging Het
Colgalt1 T C 8: 71,623,158 V483A probably damaging Het
Dcdc2b T C 4: 129,610,311 probably null Het
Dsg2 A T 18: 20,591,853 T439S probably benign Het
Dtx1 A G 5: 120,682,624 Y455H probably damaging Het
Frmpd1 C A 4: 45,284,899 S1240* probably null Het
Gypa T A 8: 80,500,931 H69Q unknown Het
Mfap5 G A 6: 122,525,992 V54I probably damaging Het
Mroh7 C T 4: 106,703,184 G641E probably damaging Het
Mvd C T 8: 122,439,703 R65H probably benign Het
Olfr293 A G 7: 86,664,294 S211G probably benign Het
Pkd1 A G 17: 24,581,276 T3004A possibly damaging Het
Pkhd1 T A 1: 20,209,246 R2949S probably damaging Het
Ptpro T C 6: 137,386,352 Y495H probably benign Het
Rfc4 G T 16: 23,115,428 Q208K probably benign Het
Rpa2 T C 4: 132,770,582 S52P probably damaging Het
Sirpb1c G T 3: 15,838,758 T94K possibly damaging Het
Sis A T 3: 72,921,437 N1136K probably damaging Het
Spp2 T A 1: 88,420,680 probably null Het
Ubr3 C T 2: 69,951,362 T628I probably damaging Het
Vmn1r213 A G 13: 23,011,649 H134R probably damaging Het
Vmn2r59 T C 7: 42,012,298 R698G probably benign Het
Other mutations in Pigs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Pigs APN 11 78340031 missense probably benign
feral UTSW 11 78336739 missense possibly damaging 0.94
R0490:Pigs UTSW 11 78335625 missense probably damaging 1.00
R1027:Pigs UTSW 11 78336825 missense probably damaging 1.00
R1073:Pigs UTSW 11 78335605 missense probably benign 0.09
R1157:Pigs UTSW 11 78328994 missense possibly damaging 0.87
R1754:Pigs UTSW 11 78337847 missense probably damaging 0.99
R1881:Pigs UTSW 11 78341756 missense probably benign 0.00
R2171:Pigs UTSW 11 78328812 missense probably damaging 1.00
R2386:Pigs UTSW 11 78332986 missense probably damaging 1.00
R4928:Pigs UTSW 11 78329002 missense probably damaging 0.99
R5206:Pigs UTSW 11 78333723 missense probably damaging 0.98
R5480:Pigs UTSW 11 78329075 missense possibly damaging 0.58
R5665:Pigs UTSW 11 78328769 synonymous probably null
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6159:Pigs UTSW 11 78328500 missense probably benign 0.01
R6572:Pigs UTSW 11 78339364 missense probably damaging 0.98
R6618:Pigs UTSW 11 78341230 missense probably damaging 1.00
R7052:Pigs UTSW 11 78341385 missense probably damaging 1.00
R7065:Pigs UTSW 11 78336739 missense possibly damaging 0.94
R7352:Pigs UTSW 11 78328812 missense probably damaging 1.00
R7851:Pigs UTSW 11 78336787 missense probably damaging 1.00
R7934:Pigs UTSW 11 78336787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCTTTGGACTTACCGGCTTG -3'
(R):5'- AGAGTTCATTTTGCCCTGCCACTG -3'

Sequencing Primer
(F):5'- CCTAAAACAGGATGACCGTTTG -3'
(R):5'- TGCCACTGGTCTATACTCAAAG -3'
Posted On2013-08-06