Incidental Mutation 'R8253:Fam13c'
ID640140
Institutional Source Beutler Lab
Gene Symbol Fam13c
Ensembl Gene ENSMUSG00000043259
Gene Namefamily with sequence similarity 13, member C
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location70440481-70558736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70553203 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 520 (S520P)
Ref Sequence ENSEMBL: ENSMUSP00000051375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046513] [ENSMUST00000062883] [ENSMUST00000105436] [ENSMUST00000173042]
Predicted Effect probably benign
Transcript: ENSMUST00000046513
SMART Domains Protein: ENSMUSP00000045807
Gene: ENSMUSG00000037747

DomainStartEndE-ValueType
FN3 49 142 6.16e-2 SMART
Blast:FN3 188 262 2e-45 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000062883
AA Change: S520P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051375
Gene: ENSMUSG00000043259
AA Change: S520P

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 529 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105436
AA Change: S438P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101076
Gene: ENSMUSG00000043259
AA Change: S438P

DomainStartEndE-ValueType
low complexity region 118 140 N/A INTRINSIC
low complexity region 192 212 N/A INTRINSIC
coiled coil region 222 290 N/A INTRINSIC
coiled coil region 447 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173042
AA Change: S519P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134648
Gene: ENSMUSG00000043259
AA Change: S519P

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 528 556 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Fam13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Fam13c APN 10 70448816 critical splice donor site probably null
IGL02060:Fam13c APN 10 70553141 missense probably damaging 1.00
IGL03218:Fam13c APN 10 70448769 missense possibly damaging 0.46
R0270:Fam13c UTSW 10 70544513 missense probably benign 0.05
R0418:Fam13c UTSW 10 70534761 missense probably damaging 1.00
R0617:Fam13c UTSW 10 70536352 splice site probably benign
R1712:Fam13c UTSW 10 70554573 missense possibly damaging 0.80
R1967:Fam13c UTSW 10 70551735 missense probably damaging 1.00
R2165:Fam13c UTSW 10 70542693 missense probably damaging 1.00
R3836:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3837:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3838:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3839:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R4059:Fam13c UTSW 10 70554508 missense probably damaging 1.00
R4768:Fam13c UTSW 10 70551750 missense probably damaging 0.96
R4951:Fam13c UTSW 10 70551791 critical splice donor site probably null
R5259:Fam13c UTSW 10 70441063 missense probably benign 0.16
R5384:Fam13c UTSW 10 70553069 missense probably benign 0.03
R5715:Fam13c UTSW 10 70534840 missense probably damaging 1.00
R6322:Fam13c UTSW 10 70498891 missense probably damaging 0.99
R6404:Fam13c UTSW 10 70448816 critical splice donor site probably null
R6723:Fam13c UTSW 10 70554525 missense probably damaging 1.00
R7111:Fam13c UTSW 10 70554506 missense probably benign 0.23
R8306:Fam13c UTSW 10 70553153 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGGACATGAAGCACTCTG -3'
(R):5'- TTCCCAGTTGAGAAGCCAAC -3'

Sequencing Primer
(F):5'- CATGAAGCACTCTGTGACTATTTGGC -3'
(R):5'- AAGCCAACTGGATGGTGCATTTTTAG -3'
Posted On2020-07-28