Incidental Mutation 'R8253:Palm'
ID640141
Institutional Source Beutler Lab
Gene Symbol Palm
Ensembl Gene ENSMUSG00000035863
Gene Nameparalemmin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79793572-79820896 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 79807677 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 80 (K80*)
Ref Sequence ENSEMBL: ENSMUSP00000040596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046945] [ENSMUST00000105379]
Predicted Effect probably null
Transcript: ENSMUST00000046945
AA Change: K80*
SMART Domains Protein: ENSMUSP00000040596
Gene: ENSMUSG00000035863
AA Change: K80*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:Paralemmin 71 383 4.2e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105379
AA Change: K80*
SMART Domains Protein: ENSMUSP00000101018
Gene: ENSMUSG00000035863
AA Change: K80*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:Paralemmin 70 339 1.5e-123 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paralemmin protein family. The product of this gene is a prenylated and palmitoylated phosphoprotein that associates with the cytoplasmic face of plasma membranes and is implicated in plasma membrane dynamics in neurons and other cell types. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Palm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Palm APN 10 79816787 splice site probably benign
IGL03080:Palm APN 10 79819117 missense probably damaging 1.00
IGL03143:Palm APN 10 79816783 splice site probably benign
R0681:Palm UTSW 10 79819493 missense probably benign 0.35
R1476:Palm UTSW 10 79815187 missense possibly damaging 0.50
R1534:Palm UTSW 10 79816903 missense probably damaging 1.00
R3439:Palm UTSW 10 79816784 splice site probably benign
R4327:Palm UTSW 10 79807686 missense probably benign 0.31
R4328:Palm UTSW 10 79807686 missense probably benign 0.31
R4329:Palm UTSW 10 79807686 missense probably benign 0.31
R6586:Palm UTSW 10 79809531 missense probably benign 0.07
R7341:Palm UTSW 10 79816863 missense probably damaging 0.98
R7977:Palm UTSW 10 79793705 start gained probably benign
R7987:Palm UTSW 10 79793705 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTGACCTGAGTCCCGATTCTAAC -3'
(R):5'- TCACACCTGCTCCTGTGTAG -3'

Sequencing Primer
(F):5'- GAGTCCCGATTCTAACTTTGCC -3'
(R):5'- CACCTGCTCCTGTGTAGGGATG -3'
Posted On2020-07-28