Incidental Mutation 'R8253:Atad2b'
ID640144
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene NameATPase family, AAA domain containing 2B
SynonymsD530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location4917353-5047394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4974159 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 670 (S670T)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045664
AA Change: S670T

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: S670T

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAAGGCCCTGTGTACAGAAG -3'
(R):5'- ACACCATTTACAGACAACATGTGAG -3'

Sequencing Primer
(F):5'- TACAGAAGCCGCCCTGACTG -3'
(R):5'- CATTTACAGACAACATGTGAGTTCTG -3'
Posted On2020-07-28