Incidental Mutation 'R8253:Zbtb42'
ID640146
Institutional Source Beutler Lab
Gene Symbol Zbtb42
Ensembl Gene ENSMUSG00000037638
Gene Namezinc finger and BTB domain containing 42
SynonymsGm5188, simiRP58
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112678828-112682747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112680312 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 307 (L307R)
Ref Sequence ENSEMBL: ENSMUSP00000133152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169593] [ENSMUST00000173942] [ENSMUST00000174780]
Predicted Effect probably damaging
Transcript: ENSMUST00000169593
AA Change: L307R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133152
Gene: ENSMUSG00000037638
AA Change: L307R

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
BTB 24 122 8.88e-22 SMART
low complexity region 226 241 N/A INTRINSIC
ZnF_C2H2 292 314 3.02e0 SMART
ZnF_C2H2 332 354 2.02e-1 SMART
ZnF_C2H2 360 382 5.06e-2 SMART
ZnF_C2H2 388 411 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173942
SMART Domains Protein: ENSMUSP00000133987
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Blast:BTB 1 40 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174780
SMART Domains Protein: ENSMUSP00000134028
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Pfam:BTB 1 40 1.3e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the C2H2 zinc finger protein family. This protein is predicted to have a pox virus and zinc finger (POZ) domain at the N-terminus and four zinc finger domains at the C-terminus. In human and mouse, the protein localizes to the nuclei of skeletal muscle cells. Knockdown of this gene in zebrafish results in abnormal skeletal muscle development and myofibrillar disorganization. A novel homozygous variant of the human gene has been associated with lethal congenital contracture syndrome, an autosomal recessive disorder that results in muscle wasting. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Other mutations in Zbtb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Zbtb42 APN 12 112680284 missense probably benign 0.35
R0607:Zbtb42 UTSW 12 112680627 missense probably benign 0.32
R4586:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4607:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4609:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4890:Zbtb42 UTSW 12 112680427 nonsense probably null
R5143:Zbtb42 UTSW 12 112679514 missense probably damaging 1.00
R5933:Zbtb42 UTSW 12 112680621 missense probably damaging 1.00
R6066:Zbtb42 UTSW 12 112679607 missense probably damaging 1.00
R6245:Zbtb42 UTSW 12 112679535 missense probably damaging 1.00
R6974:Zbtb42 UTSW 12 112680390 missense probably damaging 0.97
R8092:Zbtb42 UTSW 12 112679841 missense probably damaging 1.00
Z1176:Zbtb42 UTSW 12 112680199 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCTCAGAACAAGATAGCAGCAG -3'
(R):5'- ACGCAGGTATAGGGCTTCTC -3'

Sequencing Primer
(F):5'- GATCCCCACCACCAGTCTGTG -3'
(R):5'- GGCTTCTCCCCAGAGTGTGTC -3'
Posted On2020-07-28