Incidental Mutation 'R8253:Snx18'
ID640148
Institutional Source Beutler Lab
Gene Symbol Snx18
Ensembl Gene ENSMUSG00000042364
Gene Namesorting nexin 18
SynonymsSnag1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location113592179-113618564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113594781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 559 (D559V)
Ref Sequence ENSEMBL: ENSMUSP00000104864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109241]
Predicted Effect probably damaging
Transcript: ENSMUST00000109241
AA Change: D559V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104864
Gene: ENSMUSG00000042364
AA Change: D559V

DomainStartEndE-ValueType
SH3 3 60 1.04e-14 SMART
low complexity region 61 76 N/A INTRINSIC
low complexity region 82 105 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
PX 264 373 8.75e-22 SMART
Pfam:BAR_3_WASP_bdg 377 613 7.1e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Snx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Snx18 APN 13 113617516 missense probably benign 0.13
IGL02068:Snx18 APN 13 113617065 missense probably damaging 1.00
IGL02195:Snx18 APN 13 113616840 missense probably damaging 0.99
IGL02541:Snx18 APN 13 113594766 missense probably damaging 0.98
R2419:Snx18 UTSW 13 113617219 missense possibly damaging 0.52
R2958:Snx18 UTSW 13 113616886 nonsense probably null
R3010:Snx18 UTSW 13 113616886 nonsense probably null
R3011:Snx18 UTSW 13 113616886 nonsense probably null
R4461:Snx18 UTSW 13 113617195 missense probably damaging 1.00
R4557:Snx18 UTSW 13 113617828 missense probably damaging 1.00
R4732:Snx18 UTSW 13 113617774 missense probably benign 0.04
R4733:Snx18 UTSW 13 113617774 missense probably benign 0.04
R5308:Snx18 UTSW 13 113616847 nonsense probably null
R6157:Snx18 UTSW 13 113617189 missense probably damaging 1.00
R6995:Snx18 UTSW 13 113594729 missense probably damaging 0.99
R8092:Snx18 UTSW 13 113617149 missense probably damaging 1.00
Z1177:Snx18 UTSW 13 113618145 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGTCCCATGTGCAGTCATTAG -3'
(R):5'- TTAGGCAAATACTGACGGTACC -3'

Sequencing Primer
(F):5'- TTCCAACTTCTGGGTCAC -3'
(R):5'- ATACTGACGGTACCCAAGTTCCTG -3'
Posted On2020-07-28