Incidental Mutation 'R8253:Cyth4'
ID640150
Institutional Source Beutler Lab
Gene Symbol Cyth4
Ensembl Gene ENSMUSG00000018008
Gene Namecytohesin 4
Synonyms5830469K17Rik, 2510004M07Rik, Pscd4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location78597047-78622019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78602737 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 22 (I22V)
Ref Sequence ENSEMBL: ENSMUSP00000042698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043069]
Predicted Effect probably benign
Transcript: ENSMUST00000043069
AA Change: I22V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042698
Gene: ENSMUSG00000018008
AA Change: I22V

DomainStartEndE-ValueType
Sec7 58 243 1.05e-90 SMART
PH 260 377 2.11e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD family of proteins, which have an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family function as GEPs for ADP-ribosylation factors (ARFs), which are guanine nucleotide-binding proteins involved in vesicular trafficking pathways. This protein exhibits GEP activity in vitro with ARF1 and ARF5, but is inactive with ARF6. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Cyth4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Cyth4 APN 15 78619913 missense probably benign 0.00
R0522:Cyth4 UTSW 15 78615785 missense possibly damaging 0.67
R0584:Cyth4 UTSW 15 78609878 splice site probably null
R2018:Cyth4 UTSW 15 78608171 missense probably damaging 1.00
R3804:Cyth4 UTSW 15 78609802 missense probably damaging 1.00
R3811:Cyth4 UTSW 15 78604649 missense probably damaging 1.00
R4728:Cyth4 UTSW 15 78602713 missense probably benign 0.01
R4738:Cyth4 UTSW 15 78605874 missense probably benign 0.02
R5392:Cyth4 UTSW 15 78606985 missense probably damaging 1.00
R5594:Cyth4 UTSW 15 78607075 unclassified probably null
R6414:Cyth4 UTSW 15 78608146 missense probably damaging 0.97
R7241:Cyth4 UTSW 15 78607045 missense probably benign 0.38
R7472:Cyth4 UTSW 15 78605894 missense probably damaging 1.00
R8372:Cyth4 UTSW 15 78597135 start gained probably benign
Z1177:Cyth4 UTSW 15 78619919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCATCATGGGTCTCAC -3'
(R):5'- TGAACATTTGGTCAGGAGAGTG -3'

Sequencing Primer
(F):5'- ATCATGGGTCTCACTTTATTTCAGG -3'
(R):5'- CTTGTGGGCATATGTAGTTTAGCC -3'
Posted On2020-07-28