Incidental Mutation 'R8253:Pkp2'
ID640151
Institutional Source Beutler Lab
Gene Symbol Pkp2
Ensembl Gene ENSMUSG00000041957
Gene Nameplakophilin 2
Synonyms1200008D14Rik, Pkp2l, 1200012P04Rik
Accession Numbers

NCBI RefSeq: NM_026163.2; MGI: 1914701

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location16213318-16272712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16268542 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 689 (V689D)
Ref Sequence ENSEMBL: ENSMUSP00000036890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039408]
Predicted Effect probably damaging
Transcript: ENSMUST00000039408
AA Change: V689D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036890
Gene: ENSMUSG00000041957
AA Change: V689D

DomainStartEndE-ValueType
low complexity region 258 271 N/A INTRINSIC
ARM 342 382 7.5e-9 SMART
ARM 384 425 5.14e-7 SMART
Blast:ARM 426 481 2e-29 BLAST
ARM 484 530 8.76e-1 SMART
ARM 631 672 2.98e-3 SMART
Blast:ARM 677 718 2e-11 BLAST
Blast:ARM 720 763 5e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 3487374
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with impaired heart formation, hemopericardium, and hemoperitoneum. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Uba2 T C 7: 34,150,898 M377V probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Pkp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0014:Pkp2 UTSW 16 16240522 missense probably benign 0.08
R0131:Pkp2 UTSW 16 16240713 splice site probably benign
R0581:Pkp2 UTSW 16 16269783 splice site probably benign
R0722:Pkp2 UTSW 16 16247028 missense probably benign
R0882:Pkp2 UTSW 16 16269711 missense probably damaging 1.00
R0942:Pkp2 UTSW 16 16226030 missense probably benign
R1236:Pkp2 UTSW 16 16225902 missense probably benign
R1265:Pkp2 UTSW 16 16225304 missense probably benign 0.00
R1674:Pkp2 UTSW 16 16240558 missense possibly damaging 0.50
R1687:Pkp2 UTSW 16 16268709 critical splice donor site probably null
R1769:Pkp2 UTSW 16 16262697 missense probably damaging 1.00
R2094:Pkp2 UTSW 16 16246967 missense probably damaging 1.00
R4360:Pkp2 UTSW 16 16268682 missense probably benign 0.03
R4739:Pkp2 UTSW 16 16230724 missense probably damaging 0.99
R5162:Pkp2 UTSW 16 16260336 missense probably damaging 1.00
R5607:Pkp2 UTSW 16 16260375 missense probably damaging 0.98
R6334:Pkp2 UTSW 16 16226069 missense probably damaging 0.99
R6918:Pkp2 UTSW 16 16272218 missense probably damaging 1.00
R7274:Pkp2 UTSW 16 16246929 missense possibly damaging 0.92
R7408:Pkp2 UTSW 16 16261673 missense possibly damaging 0.50
R7698:Pkp2 UTSW 16 16240659 missense probably benign 0.01
R7788:Pkp2 UTSW 16 16225408 missense probably benign 0.01
R8030:Pkp2 UTSW 16 16246910 missense probably benign
R8056:Pkp2 UTSW 16 16213400 missense probably benign 0.28
R8161:Pkp2 UTSW 16 16213449 missense probably damaging 0.99
Z1176:Pkp2 UTSW 16 16230700 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCCATGTGCAGTAACCC -3'
(R):5'- AAGAGACTTACCCTTCCCCTATG -3'

Sequencing Primer
(F):5'- TACTCATGTGCAGTAACCCCC -3'
(R):5'- GCTGATGGTCATAATTTTCTGCAGAC -3'
Posted On2020-07-28