Incidental Mutation 'R8252:Olfr469'
ID640185
Institutional Source Beutler Lab
Gene Symbol Olfr469
Ensembl Gene ENSMUSG00000095910
Gene Nameolfactory receptor 469
SynonymsMOR204-21, GA_x6K02T2PBJ9-10152980-10152036
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8252 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107820566-107825541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107822569 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 300 (I300T)
Ref Sequence ENSEMBL: ENSMUSP00000075122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075704]
Predicted Effect probably damaging
Transcript: ENSMUST00000075704
AA Change: I300T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075122
Gene: ENSMUSG00000095910
AA Change: I300T

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.3e-53 PFAM
Pfam:7tm_1 44 293 2.4e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,971,272 probably benign Het
Ano4 A G 10: 88,981,019 I644T probably damaging Het
Arhgap18 T A 10: 26,854,936 D203E probably benign Het
Ascc3 T A 10: 50,642,610 M337K probably benign Het
Atg13 G C 2: 91,680,354 P343A probably benign Het
Cacna1c C T 6: 118,657,374 V1058I Het
Cd180 A G 13: 102,705,996 T517A probably benign Het
Cd1d2 A C 3: 86,987,068 I48L probably benign Het
Cdh19 C T 1: 110,889,885 C709Y probably benign Het
Chst10 T C 1: 38,884,352 D51G probably benign Het
Clec2g G A 6: 128,981,372 E184K probably benign Het
Col19a1 T A 1: 24,279,967 H1014L probably benign Het
Fam135b T A 15: 71,533,023 H58L probably benign Het
Fam171b A G 2: 83,878,242 I363V probably benign Het
Hecw1 C A 13: 14,340,840 G236W probably damaging Het
Htra3 A G 5: 35,652,961 M459T probably benign Het
Iglc2 A T 16: 19,198,770 C27* probably null Het
Il1f8 A T 2: 24,158,813 T77S possibly damaging Het
Kif1b A T 4: 149,273,805 N135K probably damaging Het
Krt5 A T 15: 101,712,359 I151N probably damaging Het
Lama4 A T 10: 39,060,146 M606L probably benign Het
Lgr6 T A 1: 135,003,477 S280C probably null Het
Msh3 T A 13: 92,221,061 T967S probably damaging Het
Mum1 A G 10: 80,241,860 I656V probably benign Het
Ndufb4 T C 16: 37,654,275 T29A probably benign Het
Nfe2l1 T C 11: 96,819,232 M724V probably benign Het
Nudt12 T C 17: 59,011,094 Y52C probably damaging Het
Nutm1 G T 2: 112,251,829 Q301K probably damaging Het
Olfr1189 A G 2: 88,592,667 R288G probably damaging Het
Olfr325 T A 11: 58,581,132 I96N probably damaging Het
Olfr49 T A 14: 54,282,247 Y216F possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pcdha11 G C 18: 37,007,537 V740L possibly damaging Het
Pkd1l2 T C 8: 117,040,733 T1273A probably benign Het
Pla2g4a T C 1: 149,851,307 D574G probably damaging Het
Prrc2b A T 2: 32,219,380 Q1719L possibly damaging Het
Psap A G 10: 60,277,689 probably benign Het
Rab11fip2 C T 19: 59,936,990 S265N probably benign Het
Rnf10 A T 5: 115,260,314 D53E probably benign Het
Scgb2b11 T C 7: 32,209,339 E112G probably benign Het
Scml4 T C 10: 42,924,104 Y85H noncoding transcript Het
Setd5 T A 6: 113,150,955 Y1290N probably benign Het
Sgk1 T A 10: 21,997,399 C375S probably damaging Het
Sik2 A G 9: 50,917,115 V209A possibly damaging Het
Sipa1l2 A T 8: 125,468,671 V776D probably damaging Het
Slamf1 T A 1: 171,767,228 M1K probably null Het
Slc26a7 T C 4: 14,621,415 probably benign Het
Spg11 G T 2: 122,088,339 probably benign Het
Sry C A Y: 2,663,298 A121S possibly damaging Het
Sspo C T 6: 48,485,452 T3719I probably damaging Het
Tcap T C 11: 98,384,345 S102P probably benign Het
Thap7 T C 16: 17,528,622 R166G probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Trim8 A G 19: 46,515,620 Y537C probably damaging Het
Ubr4 T A 4: 139,473,217 M4692K unknown Het
Uvssa A G 5: 33,392,179 S395G probably benign Het
Vgll4 G T 6: 114,890,734 T52K probably damaging Het
Vmn2r7 A G 3: 64,693,106 L548P probably benign Het
Vmn2r92 T A 17: 18,166,872 S158T probably damaging Het
Wdr70 A T 15: 8,042,856 probably benign Het
Zbtb48 A T 4: 152,020,887 C463S probably damaging Het
Other mutations in Olfr469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02205:Olfr469 APN 7 107822591 missense probably damaging 1.00
IGL02252:Olfr469 APN 7 107823146 missense probably benign 0.04
R0365:Olfr469 UTSW 7 107822917 nonsense probably null
R0647:Olfr469 UTSW 7 107823011 missense probably benign 0.02
R0863:Olfr469 UTSW 7 107823374 missense probably benign
R1830:Olfr469 UTSW 7 107823371 missense probably benign 0.02
R2189:Olfr469 UTSW 7 107822615 missense probably benign 0.09
R2316:Olfr469 UTSW 7 107822800 missense probably benign 0.25
R6187:Olfr469 UTSW 7 107822574 missense probably benign
R6305:Olfr469 UTSW 7 107822657 missense probably benign 0.01
R6774:Olfr469 UTSW 7 107823188 missense probably benign 0.06
R7019:Olfr469 UTSW 7 107823158 missense probably benign 0.04
R7205:Olfr469 UTSW 7 107822575 missense probably benign 0.01
R7466:Olfr469 UTSW 7 107822922 nonsense probably null
R8128:Olfr469 UTSW 7 107823425 missense probably damaging 1.00
R8251:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
R8253:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
Z1176:Olfr469 UTSW 7 107822993 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGAGCATCTACCCTCTGTAGTTG -3'
(R):5'- TGAAGATGCGCTCCACTGAG -3'

Sequencing Primer
(F):5'- GTTGCTAAAAAGCTTCCAAGTGGC -3'
(R):5'- AGAAGGCCTTCTCCACCTG -3'
Posted On2020-07-28