Incidental Mutation 'R8252:Sipa1l2'
ID640187
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R8252 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125468671 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 776 (V776D)
Ref Sequence ENSEMBL: ENSMUSP00000104405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: V776D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: V776D

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: V776D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: V776D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A G 10: 88,981,019 I644T probably damaging Het
Arhgap18 T A 10: 26,854,936 D203E probably benign Het
Ascc3 T A 10: 50,642,610 M337K probably benign Het
Atg13 G C 2: 91,680,354 P343A probably benign Het
Cacna1c C T 6: 118,657,374 V1058I Het
Cd180 A G 13: 102,705,996 T517A probably benign Het
Cd1d2 A C 3: 86,987,068 I48L probably benign Het
Cdh19 C T 1: 110,889,885 C709Y probably benign Het
Chst10 T C 1: 38,884,352 D51G probably benign Het
Clec2g G A 6: 128,981,372 E184K probably benign Het
Col19a1 T A 1: 24,279,967 H1014L probably benign Het
Fam135b T A 15: 71,533,023 H58L probably benign Het
Fam171b A G 2: 83,878,242 I363V probably benign Het
Hecw1 C A 13: 14,340,840 G236W probably damaging Het
Htra3 A G 5: 35,652,961 M459T probably benign Het
Iglc2 A T 16: 19,198,770 C27* probably null Het
Il1f8 A T 2: 24,158,813 T77S possibly damaging Het
Kif1b A T 4: 149,273,805 N135K probably damaging Het
Krt5 A T 15: 101,712,359 I151N probably damaging Het
Lama4 A T 10: 39,060,146 M606L probably benign Het
Lgr6 T A 1: 135,003,477 S280C probably null Het
Msh3 T A 13: 92,221,061 T967S probably damaging Het
Mum1 A G 10: 80,241,860 I656V probably benign Het
Ndufb4 T C 16: 37,654,275 T29A probably benign Het
Nfe2l1 T C 11: 96,819,232 M724V probably benign Het
Nudt12 T C 17: 59,011,094 Y52C probably damaging Het
Nutm1 G T 2: 112,251,829 Q301K probably damaging Het
Olfr1189 A G 2: 88,592,667 R288G probably damaging Het
Olfr325 T A 11: 58,581,132 I96N probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr49 T A 14: 54,282,247 Y216F possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pcdha11 G C 18: 37,007,537 V740L possibly damaging Het
Pkd1l2 T C 8: 117,040,733 T1273A probably benign Het
Pla2g4a T C 1: 149,851,307 D574G probably damaging Het
Prrc2b A T 2: 32,219,380 Q1719L possibly damaging Het
Psap A G 10: 60,277,689 probably benign Het
Rab11fip2 C T 19: 59,936,990 S265N probably benign Het
Rnf10 A T 5: 115,260,314 D53E probably benign Het
Scgb2b11 T C 7: 32,209,339 E112G probably benign Het
Scml4 T C 10: 42,924,104 Y85H noncoding transcript Het
Setd5 T A 6: 113,150,955 Y1290N probably benign Het
Sgk1 T A 10: 21,997,399 C375S probably damaging Het
Sik2 A G 9: 50,917,115 V209A possibly damaging Het
Slamf1 T A 1: 171,767,228 M1K probably null Het
Slc26a7 T C 4: 14,621,415 probably benign Het
Sry C A Y: 2,663,298 A121S possibly damaging Het
Sspo C T 6: 48,485,452 T3719I probably damaging Het
Tcap T C 11: 98,384,345 S102P probably benign Het
Thap7 T C 16: 17,528,622 R166G probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Trim8 A G 19: 46,515,620 Y537C probably damaging Het
Ubr4 T A 4: 139,473,217 M4692K unknown Het
Uvssa A G 5: 33,392,179 S395G probably benign Het
Vgll4 G T 6: 114,890,734 T52K probably damaging Het
Vmn2r7 A G 3: 64,693,106 L548P probably benign Het
Vmn2r92 T A 17: 18,166,872 S158T probably damaging Het
Zbtb48 A T 4: 152,020,887 C463S probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCGTGATGAAGCTGAATTTTGC -3'
(R):5'- TATGGGTACACACCTGCTGG -3'

Sequencing Primer
(F):5'- GCTGAATTTTGCAGAAGTGTCCAC -3'
(R):5'- CCAAGGTTAATGTCAGGAGTCCTC -3'
Posted On2020-07-28