Incidental Mutation 'R8252:Ndufb4'
ID640209
Institutional Source Beutler Lab
Gene Symbol Ndufb4
Ensembl Gene ENSMUSG00000022820
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R8252 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location37647170-37654453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37654275 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 29 (T29A)
Ref Sequence ENSEMBL: ENSMUSP00000023514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023514]
Predicted Effect probably benign
Transcript: ENSMUST00000023514
AA Change: T29A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023514
Gene: ENSMUSG00000022820
AA Change: T29A

DomainStartEndE-ValueType
Pfam:NDUF_B4 5 128 5.5e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,971,272 probably benign Het
Ano4 A G 10: 88,981,019 I644T probably damaging Het
Arhgap18 T A 10: 26,854,936 D203E probably benign Het
Ascc3 T A 10: 50,642,610 M337K probably benign Het
Atg13 G C 2: 91,680,354 P343A probably benign Het
Cacna1c C T 6: 118,657,374 V1058I Het
Cd180 A G 13: 102,705,996 T517A probably benign Het
Cd1d2 A C 3: 86,987,068 I48L probably benign Het
Cdh19 C T 1: 110,889,885 C709Y probably benign Het
Chst10 T C 1: 38,884,352 D51G probably benign Het
Clec2g G A 6: 128,981,372 E184K probably benign Het
Col19a1 T A 1: 24,279,967 H1014L probably benign Het
Fam135b T A 15: 71,533,023 H58L probably benign Het
Fam171b A G 2: 83,878,242 I363V probably benign Het
Hecw1 C A 13: 14,340,840 G236W probably damaging Het
Htra3 A G 5: 35,652,961 M459T probably benign Het
Iglc2 A T 16: 19,198,770 C27* probably null Het
Il1f8 A T 2: 24,158,813 T77S possibly damaging Het
Kif1b A T 4: 149,273,805 N135K probably damaging Het
Krt5 A T 15: 101,712,359 I151N probably damaging Het
Lama4 A T 10: 39,060,146 M606L probably benign Het
Lgr6 T A 1: 135,003,477 S280C probably null Het
Msh3 T A 13: 92,221,061 T967S probably damaging Het
Mum1 A G 10: 80,241,860 I656V probably benign Het
Nfe2l1 T C 11: 96,819,232 M724V probably benign Het
Nudt12 T C 17: 59,011,094 Y52C probably damaging Het
Nutm1 G T 2: 112,251,829 Q301K probably damaging Het
Olfr1189 A G 2: 88,592,667 R288G probably damaging Het
Olfr325 T A 11: 58,581,132 I96N probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr49 T A 14: 54,282,247 Y216F possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pcdha11 G C 18: 37,007,537 V740L possibly damaging Het
Pkd1l2 T C 8: 117,040,733 T1273A probably benign Het
Pla2g4a T C 1: 149,851,307 D574G probably damaging Het
Prrc2b A T 2: 32,219,380 Q1719L possibly damaging Het
Psap A G 10: 60,277,689 probably benign Het
Rab11fip2 C T 19: 59,936,990 S265N probably benign Het
Rnf10 A T 5: 115,260,314 D53E probably benign Het
Scgb2b11 T C 7: 32,209,339 E112G probably benign Het
Scml4 T C 10: 42,924,104 Y85H noncoding transcript Het
Setd5 T A 6: 113,150,955 Y1290N probably benign Het
Sgk1 T A 10: 21,997,399 C375S probably damaging Het
Sik2 A G 9: 50,917,115 V209A possibly damaging Het
Sipa1l2 A T 8: 125,468,671 V776D probably damaging Het
Slamf1 T A 1: 171,767,228 M1K probably null Het
Slc26a7 T C 4: 14,621,415 probably benign Het
Spg11 G T 2: 122,088,339 probably benign Het
Sry C A Y: 2,663,298 A121S possibly damaging Het
Sspo C T 6: 48,485,452 T3719I probably damaging Het
Tcap T C 11: 98,384,345 S102P probably benign Het
Thap7 T C 16: 17,528,622 R166G probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Trim8 A G 19: 46,515,620 Y537C probably damaging Het
Ubr4 T A 4: 139,473,217 M4692K unknown Het
Uvssa A G 5: 33,392,179 S395G probably benign Het
Vgll4 G T 6: 114,890,734 T52K probably damaging Het
Vmn2r7 A G 3: 64,693,106 L548P probably benign Het
Vmn2r92 T A 17: 18,166,872 S158T probably damaging Het
Wdr70 A T 15: 8,042,856 probably benign Het
Zbtb48 A T 4: 152,020,887 C463S probably damaging Het
Other mutations in Ndufb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02584:Ndufb4 APN 16 37649170 splice site probably benign
R4389:Ndufb4 UTSW 16 37647670 missense probably benign
R5345:Ndufb4 UTSW 16 37654178 critical splice donor site probably null
R8509:Ndufb4 UTSW 16 37649144 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGACCACTGAGCCGAAG -3'
(R):5'- AGGATTGGCAAAGGCTCCAC -3'

Sequencing Primer
(F):5'- GCCGAAGTTGAAGGGCC -3'
(R):5'- TTCCTGCCAGAGCGCCTTG -3'
Posted On2020-07-28