Incidental Mutation 'R8252:Sry'
ID640215
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Namesex determining region of Chr Y
SynonymsTdy, Tdf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R8252 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location2662471-2663658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 2663298 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 121 (A121S)
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
AlphaFold Q05738
Predicted Effect possibly damaging
Transcript: ENSMUST00000091178
AA Change: A121S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036
AA Change: A121S

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,971,272 probably benign Het
Ano4 A G 10: 88,981,019 I644T probably damaging Het
Arhgap18 T A 10: 26,854,936 D203E probably benign Het
Ascc3 T A 10: 50,642,610 M337K probably benign Het
Atg13 G C 2: 91,680,354 P343A probably benign Het
Cacna1c C T 6: 118,657,374 V1058I Het
Cd180 A G 13: 102,705,996 T517A probably benign Het
Cd1d2 A C 3: 86,987,068 I48L probably benign Het
Cdh19 C T 1: 110,889,885 C709Y probably benign Het
Chst10 T C 1: 38,884,352 D51G probably benign Het
Clec2g G A 6: 128,981,372 E184K probably benign Het
Col19a1 T A 1: 24,279,967 H1014L probably benign Het
Fam135b T A 15: 71,533,023 H58L probably benign Het
Fam171b A G 2: 83,878,242 I363V probably benign Het
Hecw1 C A 13: 14,340,840 G236W probably damaging Het
Htra3 A G 5: 35,652,961 M459T probably benign Het
Iglc2 A T 16: 19,198,770 C27* probably null Het
Il1f8 A T 2: 24,158,813 T77S possibly damaging Het
Kif1b A T 4: 149,273,805 N135K probably damaging Het
Krt5 A T 15: 101,712,359 I151N probably damaging Het
Lama4 A T 10: 39,060,146 M606L probably benign Het
Lgr6 T A 1: 135,003,477 S280C probably null Het
Msh3 T A 13: 92,221,061 T967S probably damaging Het
Mum1 A G 10: 80,241,860 I656V probably benign Het
Ndufb4 T C 16: 37,654,275 T29A probably benign Het
Nfe2l1 T C 11: 96,819,232 M724V probably benign Het
Nudt12 T C 17: 59,011,094 Y52C probably damaging Het
Nutm1 G T 2: 112,251,829 Q301K probably damaging Het
Olfr1189 A G 2: 88,592,667 R288G probably damaging Het
Olfr325 T A 11: 58,581,132 I96N probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr49 T A 14: 54,282,247 Y216F possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pcdha11 G C 18: 37,007,537 V740L possibly damaging Het
Pkd1l2 T C 8: 117,040,733 T1273A probably benign Het
Pla2g4a T C 1: 149,851,307 D574G probably damaging Het
Prrc2b A T 2: 32,219,380 Q1719L possibly damaging Het
Psap A G 10: 60,277,689 probably benign Het
Rab11fip2 C T 19: 59,936,990 S265N probably benign Het
Rnf10 A T 5: 115,260,314 D53E probably benign Het
Scgb2b11 T C 7: 32,209,339 E112G probably benign Het
Scml4 T C 10: 42,924,104 Y85H noncoding transcript Het
Setd5 T A 6: 113,150,955 Y1290N probably benign Het
Sgk1 T A 10: 21,997,399 C375S probably damaging Het
Sik2 A G 9: 50,917,115 V209A possibly damaging Het
Sipa1l2 A T 8: 125,468,671 V776D probably damaging Het
Slamf1 T A 1: 171,767,228 M1K probably null Het
Slc26a7 T C 4: 14,621,415 probably benign Het
Spg11 G T 2: 122,088,339 probably benign Het
Sspo C T 6: 48,485,452 T3719I probably damaging Het
Tcap T C 11: 98,384,345 S102P probably benign Het
Thap7 T C 16: 17,528,622 R166G probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Trim8 A G 19: 46,515,620 Y537C probably damaging Het
Ubr4 T A 4: 139,473,217 M4692K unknown Het
Uvssa A G 5: 33,392,179 S395G probably benign Het
Vgll4 G T 6: 114,890,734 T52K probably damaging Het
Vmn2r7 A G 3: 64,693,106 L548P probably benign Het
Vmn2r92 T A 17: 18,166,872 S158T probably damaging Het
Wdr70 A T 15: 8,042,856 probably benign Het
Zbtb48 A T 4: 152,020,887 C463S probably damaging Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1555:Sry UTSW Y 2662975 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5266:Sry UTSW Y 2662975 missense unknown
R5305:Sry UTSW Y 2662982 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7632:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8028:Sry UTSW Y 2662638 small deletion probably benign
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8390:Sry UTSW Y 2662638 small deletion probably benign
R9027:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAAGCTGCTGGTCGTGGA -3'
(R):5'- TGAAGATCCTACACAGAGAGAAATAC -3'

Sequencing Primer
(F):5'- CATGGAACTGATGCTGCTGC -3'
(R):5'- CCCAAACTATAAATATCAGCCTCATC -3'
Posted On2020-07-28