Incidental Mutation 'R8251:Nabp1'
ID 640216
Institutional Source Beutler Lab
Gene Symbol Nabp1
Ensembl Gene ENSMUSG00000026107
Gene Name nucleic acid binding protein 1
Synonyms 4933440J18Rik, Nbp1, 4930442A21Rik, Obfc2a, 4930434H03Rik, Ssb2, 5830411E10Rik, 4930488J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R8251 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 51465862-51478425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51477578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 44 (S44T)
Ref Sequence ENSEMBL: ENSMUSP00000027279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027279] [ENSMUST00000185534] [ENSMUST00000186003] [ENSMUST00000186684] [ENSMUST00000188051] [ENSMUST00000188204] [ENSMUST00000189542] [ENSMUST00000190103]
AlphaFold Q8BGW5
Predicted Effect probably benign
Transcript: ENSMUST00000027279
AA Change: S44T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107
AA Change: S44T

DomainStartEndE-ValueType
PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185534
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186003
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186684
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188051
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188204
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189542
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190103
AA Change: S44T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107
AA Change: S44T

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Dsg4 C A 18: 20,471,164 A896E probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Ifit1bl1 T C 19: 34,594,832 Q75R possibly damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Ints7 C T 1: 191,621,433 P957L unknown Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kansl1 A G 11: 104,424,360 I284T probably benign Het
Kcnj9 A G 1: 172,326,522 S12P probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Mroh5 T C 15: 73,783,153 E653G probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr344 A C 2: 36,569,455 N286H probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Nabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Nabp1 APN 1 51477528 missense probably damaging 1.00
kinkajou UTSW 1 51471352 missense possibly damaging 0.70
R0898:Nabp1 UTSW 1 51471337 missense probably benign
R1608:Nabp1 UTSW 1 51473003 splice site probably null
R1614:Nabp1 UTSW 1 51471352 missense possibly damaging 0.70
R1956:Nabp1 UTSW 1 51477845 missense probably damaging 0.96
R2208:Nabp1 UTSW 1 51477614 nonsense probably null
R4632:Nabp1 UTSW 1 51474602 nonsense probably null
R5996:Nabp1 UTSW 1 51471385 missense probably benign 0.00
R6754:Nabp1 UTSW 1 51474540 missense probably damaging 0.97
R7322:Nabp1 UTSW 1 51473070 missense probably damaging 0.98
R8302:Nabp1 UTSW 1 51472339 missense probably benign 0.00
X0063:Nabp1 UTSW 1 51477849 missense probably benign 0.00
Z1176:Nabp1 UTSW 1 51477725 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAGAGCCAAACAACTTCAG -3'
(R):5'- TAGGTAAGTGAGGTCCGCAG -3'

Sequencing Primer
(F):5'- CTTCAGAACCCCGAAGTCG -3'
(R):5'- AGAGCTCGGACCTCTTCC -3'
Posted On 2020-07-28