Incidental Mutation 'R8251:Kcnj9'
ID640219
Institutional Source Beutler Lab
Gene Symbol Kcnj9
Ensembl Gene ENSMUSG00000038026
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 9
SynonymsKir3.3, 1700085N21Rik, Girk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8251 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172320501-172329318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172326522 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 12 (S12P)
Ref Sequence ENSEMBL: ENSMUSP00000060110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062387] [ENSMUST00000194204]
Predicted Effect probably benign
Transcript: ENSMUST00000062387
AA Change: S12P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026
AA Change: S12P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194204
AA Change: S12P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141633
Gene: ENSMUSG00000038026
AA Change: S12P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 361 7.4e-165 PFAM
low complexity region 362 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It associates with another G-protein-activated potassium channel to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus does not result in any overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Dsg4 C A 18: 20,471,164 A896E probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Ifit1bl1 T C 19: 34,594,832 Q75R possibly damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Ints7 C T 1: 191,621,433 P957L unknown Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kansl1 A G 11: 104,424,360 I284T probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Mroh5 T C 15: 73,783,153 E653G probably benign Het
Nabp1 A T 1: 51,477,578 S44T probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr344 A C 2: 36,569,455 N286H probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Kcnj9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Kcnj9 APN 1 172325708 missense probably damaging 1.00
IGL02616:Kcnj9 APN 1 172325964 missense probably damaging 1.00
R0131:Kcnj9 UTSW 1 172326198 missense probably damaging 0.99
R0131:Kcnj9 UTSW 1 172326198 missense probably damaging 0.99
R0132:Kcnj9 UTSW 1 172326198 missense probably damaging 0.99
R0505:Kcnj9 UTSW 1 172323024 missense probably benign 0.01
R0591:Kcnj9 UTSW 1 172323098 missense probably damaging 0.98
R0726:Kcnj9 UTSW 1 172325921 missense probably damaging 1.00
R1178:Kcnj9 UTSW 1 172322963 missense probably benign 0.00
R1485:Kcnj9 UTSW 1 172326362 missense probably benign 0.24
R1989:Kcnj9 UTSW 1 172326149 missense probably benign 0.05
R5165:Kcnj9 UTSW 1 172323157 missense probably benign 0.00
R6245:Kcnj9 UTSW 1 172326137 missense probably damaging 1.00
R6344:Kcnj9 UTSW 1 172326146 missense probably benign 0.01
R6903:Kcnj9 UTSW 1 172326056 missense probably damaging 1.00
R7309:Kcnj9 UTSW 1 172326258 missense probably damaging 1.00
R8043:Kcnj9 UTSW 1 172326056 missense probably damaging 1.00
Z1177:Kcnj9 UTSW 1 172323183 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CGTTGAGGTTGTTGACGCAC -3'
(R):5'- TCGTTCCCAATCCACCAGTG -3'

Sequencing Primer
(F):5'- GTGTCCTCCAGGTGTTCCAG -3'
(R):5'- CCACCAGTGGGGAAAAACTAAG -3'
Posted On2020-07-28