Incidental Mutation 'R8251:Ints7'
ID640221
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R8251 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 191621433 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 957 (P957L)
Ref Sequence ENSEMBL: ENSMUSP00000036277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect unknown
Transcript: ENSMUST00000045450
AA Change: P957L
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: P957L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Dsg4 C A 18: 20,471,164 A896E probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Ifit1bl1 T C 19: 34,594,832 Q75R possibly damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kansl1 A G 11: 104,424,360 I284T probably benign Het
Kcnj9 A G 1: 172,326,522 S12P probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Nabp1 A T 1: 51,477,578 S44T probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr344 A C 2: 36,569,455 N286H probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
PIT4810001:Ints7 UTSW 1 191596236 missense probably damaging 0.99
R0294:Ints7 UTSW 1 191611891 missense possibly damaging 0.91
R0479:Ints7 UTSW 1 191614554 splice site probably null
R0698:Ints7 UTSW 1 191594464 missense probably damaging 0.97
R1420:Ints7 UTSW 1 191613057 missense possibly damaging 0.73
R1680:Ints7 UTSW 1 191621162 splice site probably null
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R2291:Ints7 UTSW 1 191606203 splice site probably null
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6048:Ints7 UTSW 1 191621412 utr 3 prime probably benign
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
R7037:Ints7 UTSW 1 191619605 missense probably benign 0.16
R7163:Ints7 UTSW 1 191617837 missense possibly damaging 0.67
R7603:Ints7 UTSW 1 191596224 missense probably damaging 1.00
R7801:Ints7 UTSW 1 191615747 missense possibly damaging 0.84
R7899:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R8034:Ints7 UTSW 1 191613068 frame shift probably null
R8034:Ints7 UTSW 1 191613071 frame shift probably null
R8231:Ints7 UTSW 1 191596353 nonsense probably null
Z1177:Ints7 UTSW 1 191610458 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACAGCATCACAGTGGAGTC -3'
(R):5'- GCTGAGAGCCAGGTTATTTCTTACAC -3'

Sequencing Primer
(F):5'- CATCACAGTGGAGTCATCGGTG -3'
(R):5'- CAACAAAAACAACTTCACCAGAATG -3'
Posted On2020-07-28