Incidental Mutation 'R8251:Olfr344'
ID640224
Institutional Source Beutler Lab
Gene Symbol Olfr344
Ensembl Gene ENSMUSG00000096822
Gene Nameolfactory receptor 344
SynonymsGA_x6K02T2NLDC-33262744-33263673, MOR136-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8251 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36566662-36576178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36569455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 286 (N286H)
Ref Sequence ENSEMBL: ENSMUSP00000074919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075474]
Predicted Effect probably damaging
Transcript: ENSMUST00000075474
AA Change: N286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074919
Gene: ENSMUSG00000096822
AA Change: N286H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Dsg4 C A 18: 20,471,164 A896E probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Ifit1bl1 T C 19: 34,594,832 Q75R possibly damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Ints7 C T 1: 191,621,433 P957L unknown Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kansl1 A G 11: 104,424,360 I284T probably benign Het
Kcnj9 A G 1: 172,326,522 S12P probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Mroh5 T C 15: 73,783,153 E653G probably benign Het
Nabp1 A T 1: 51,477,578 S44T probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Olfr344
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr344 APN 2 36568826 missense probably damaging 1.00
IGL01450:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01452:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01458:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01466:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01470:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01476:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01477:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01478:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01480:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01481:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01487:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01522:Olfr344 APN 2 36569221 missense probably benign 0.00
IGL02141:Olfr344 APN 2 36568808 missense probably damaging 1.00
IGL02510:Olfr344 APN 2 36568681 missense possibly damaging 0.87
IGL02896:Olfr344 APN 2 36569205 missense possibly damaging 0.88
IGL03032:Olfr344 APN 2 36568704 nonsense probably null
R0081:Olfr344 UTSW 2 36568881 nonsense probably null
R0581:Olfr344 UTSW 2 36568822 missense probably damaging 1.00
R0611:Olfr344 UTSW 2 36569556 splice site probably null
R1503:Olfr344 UTSW 2 36568873 missense probably damaging 1.00
R1844:Olfr344 UTSW 2 36568777 missense probably damaging 1.00
R2320:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
R4088:Olfr344 UTSW 2 36569018 missense probably damaging 1.00
R5243:Olfr344 UTSW 2 36568643 missense probably damaging 1.00
R5747:Olfr344 UTSW 2 36568967 missense probably damaging 0.98
R5948:Olfr344 UTSW 2 36569351 missense probably damaging 1.00
R6115:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6158:Olfr344 UTSW 2 36569116 missense probably benign 0.03
R6198:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6531:Olfr344 UTSW 2 36569341 missense probably damaging 1.00
R7075:Olfr344 UTSW 2 36569180 missense probably benign 0.01
R7193:Olfr344 UTSW 2 36569236 missense probably benign 0.06
R7329:Olfr344 UTSW 2 36568696 missense probably benign
R7659:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
R8383:Olfr344 UTSW 2 36569002 missense probably benign 0.08
R8507:Olfr344 UTSW 2 36569431 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCAAGGGAATCCGCAAAG -3'
(R):5'- CCCCTTTCCCAAGATTATCAAGATC -3'

Sequencing Primer
(F):5'- AAGCCCTGTCCACATGTG -3'
(R):5'- GTGTACAGTCCAAGTTATATGCAAG -3'
Posted On2020-07-28