Mutagenetix > Incidental Mutation

Incidental Mutation 'R8251:Cenpe'

640230

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

067677-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8251 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 135251684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000062893] [ENSMUST00000062893]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000062893

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000062893

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000062893

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad11	A	T	9: 104,091,707 (GRCm38)	D463V	possibly damaging	Het
Adamtsl4	C	T	3: 95,684,574 (GRCm38)	R68Q	probably damaging	Het
Ankrd12	A	T	17: 65,984,559 (GRCm38)	M1293K	possibly damaging	Het
Arhgap21	T	C	2: 20,849,410 (GRCm38)	T1724A	probably benign	Het
C1qtnf12	T	C	4: 155,966,459 (GRCm38)	I295T	probably damaging	Het
Cacna1s	G	T	1: 136,086,723 (GRCm38)	G623W	probably damaging	Het
Cemip2	T	C	19: 21,807,401 (GRCm38)	V416A	possibly damaging	Het
Cep85l	A	T	10: 53,281,354 (GRCm38)	I751N	probably damaging	Het
Corin	T	A	5: 72,356,926 (GRCm38)	D468V	probably damaging	Het
Ctsr	A	G	13: 61,162,778 (GRCm38)	V51A	probably damaging	Het
Dnah14	A	C	1: 181,664,865 (GRCm38)	E1630A	probably damaging	Het
Dsg4	C	A	18: 20,471,164 (GRCm38)	A896E	probably damaging	Het
Ear2	T	C	14: 44,103,020 (GRCm38)	L45P	probably benign	Het
Fshr	T	G	17: 89,200,485 (GRCm38)	D43A	probably benign	Het
Gata6	G	A	18: 11,054,670 (GRCm38)	G200S	probably benign	Het
Gnaq	T	A	19: 16,335,055 (GRCm38)	M227K	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,832 (GRCm38)	Q75R	possibly damaging	Het
Impg2	A	G	16: 56,259,597 (GRCm38)	E479G	possibly damaging	Het
Ints7	C	T	1: 191,621,433 (GRCm38)	P957L	unknown	Het
Jmjd1c	T	C	10: 67,239,289 (GRCm38)	V73A	noncoding transcript	Het
Kansl1	A	G	11: 104,424,360 (GRCm38)	I284T	probably benign	Het
Kcnj9	A	G	1: 172,326,522 (GRCm38)	S12P	probably benign	Het
Krt16	A	G	11: 100,248,370 (GRCm38)		probably null	Het
Lrguk	A	T	6: 34,116,439 (GRCm38)	T632S	probably benign	Het
Man2b1	G	A	8: 85,095,129 (GRCm38)	V687M	probably damaging	Het
Mroh5	T	C	15: 73,783,153 (GRCm38)	E653G	probably benign	Het
Nabp1	A	T	1: 51,477,578 (GRCm38)	S44T	probably benign	Het
Nt5dc3	C	A	10: 86,820,227 (GRCm38)	H256Q	probably damaging	Het
Or1j15	A	C	2: 36,569,455 (GRCm38)	N286H	probably damaging	Het
Or4a81	A	T	2: 89,789,223 (GRCm38)	I43N	probably damaging	Het
Or5p50	A	G	7: 107,822,569 (GRCm38)	I300T	probably damaging	Het
Pkd2	T	C	5: 104,498,487 (GRCm38)	V720A	probably benign	Het
Pnpla6	T	A	8: 3,532,399 (GRCm38)	N706K	probably benign	Het
Polr1b	C	A	2: 129,123,166 (GRCm38)	P724Q	probably damaging	Het
Rbpjl	A	G	2: 164,413,934 (GRCm38)	E366G	probably damaging	Het
Runx1t1	A	G	4: 13,846,947 (GRCm38)	T244A	possibly damaging	Het
Slitrk3	C	T	3: 73,049,396 (GRCm38)	R681H	possibly damaging	Het
Slu7	A	G	11: 43,439,301 (GRCm38)	Y185C	probably damaging	Het
Snupn	T	A	9: 56,980,853 (GRCm38)	F231L	probably damaging	Het
Srpk2	G	A	5: 23,524,268 (GRCm38)	P458S	probably benign	Het
St3gal5	T	A	6: 72,149,160 (GRCm38)	F330I	probably benign	Het
Taf3	T	C	2: 9,918,151 (GRCm38)	D878G	possibly damaging	Het
Tex44	A	G	1: 86,427,214 (GRCm38)	N282D	probably benign	Het
Tmem126a	T	C	7: 90,450,886 (GRCm38)	I150V	probably benign	Het
Trbv21	A	G	6: 41,202,606 (GRCm38)		probably benign	Het
Vmn2r70	A	T	7: 85,565,978 (GRCm38)	L116*	probably null	Het
Vps36	A	G	8: 22,192,916 (GRCm38)	T16A	probably benign	Het
Wdr17	C	A	8: 54,657,232 (GRCm38)	G837W	probably damaging	Het
Zfp397	T	C	18: 23,960,304 (GRCm38)	V282A	probably benign	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135,231,455 (GRCm38)	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135,228,917 (GRCm38)	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135,259,351 (GRCm38)	missense	probably benign
IGL01446:Cenpe	APN	3	135,237,539 (GRCm38)	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135,228,806 (GRCm38)	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135,218,507 (GRCm38)	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135,255,477 (GRCm38)	missense	probably benign
IGL02337:Cenpe	APN	3	135,220,276 (GRCm38)	splice site	probably benign
IGL02382:Cenpe	APN	3	135,247,386 (GRCm38)	missense	probably benign
IGL02458:Cenpe	APN	3	135,230,108 (GRCm38)	nonsense	probably null
IGL02934:Cenpe	APN	3	135,264,351 (GRCm38)	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135,243,625 (GRCm38)	missense	probably benign
R0086:Cenpe	UTSW	3	135,264,424 (GRCm38)	splice site	probably benign
R0173:Cenpe	UTSW	3	135,259,983 (GRCm38)	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135,216,425 (GRCm38)	splice site	probably benign
R0411:Cenpe	UTSW	3	135,222,255 (GRCm38)	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135,246,586 (GRCm38)	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135,246,827 (GRCm38)	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135,230,082 (GRCm38)	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135,217,305 (GRCm38)	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135,264,422 (GRCm38)	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135,246,902 (GRCm38)	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135,270,900 (GRCm38)	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135,238,394 (GRCm38)	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135,239,758 (GRCm38)	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135,265,933 (GRCm38)	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135,246,496 (GRCm38)	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135,239,845 (GRCm38)	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135,268,979 (GRCm38)	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135,247,479 (GRCm38)	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135,242,493 (GRCm38)	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135,222,321 (GRCm38)	splice site	probably benign
R2118:Cenpe	UTSW	3	135,246,884 (GRCm38)	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135,239,780 (GRCm38)	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135,247,474 (GRCm38)	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135,261,636 (GRCm38)	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135,261,636 (GRCm38)	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135,248,113 (GRCm38)	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135,241,073 (GRCm38)	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135,241,021 (GRCm38)	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135,256,576 (GRCm38)	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135,222,322 (GRCm38)	splice site	probably benign
R3974:Cenpe	UTSW	3	135,235,225 (GRCm38)	splice site	probably null
R3975:Cenpe	UTSW	3	135,238,472 (GRCm38)	critical splice donor site	probably null
R3975:Cenpe	UTSW	3	135,235,225 (GRCm38)	splice site	probably null
R4151:Cenpe	UTSW	3	135,215,153 (GRCm38)	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135,243,718 (GRCm38)	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135,247,000 (GRCm38)	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135,243,708 (GRCm38)	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135,216,379 (GRCm38)	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135,248,151 (GRCm38)	missense	probably benign
R4976:Cenpe	UTSW	3	135,234,876 (GRCm38)	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135,234,928 (GRCm38)	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135,256,640 (GRCm38)	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135,247,081 (GRCm38)	missense	probably benign
R5057:Cenpe	UTSW	3	135,220,313 (GRCm38)	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135,270,954 (GRCm38)	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135,242,303 (GRCm38)	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135,230,150 (GRCm38)	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135,259,388 (GRCm38)	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135,223,265 (GRCm38)	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135,269,065 (GRCm38)	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135,235,076 (GRCm38)	nonsense	probably null
R5608:Cenpe	UTSW	3	135,235,076 (GRCm38)	nonsense	probably null
R5627:Cenpe	UTSW	3	135,235,473 (GRCm38)	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135,248,413 (GRCm38)	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135,261,580 (GRCm38)	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135,261,628 (GRCm38)	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135,260,073 (GRCm38)	nonsense	probably null
R6163:Cenpe	UTSW	3	135,269,003 (GRCm38)	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135,248,530 (GRCm38)	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135,243,775 (GRCm38)	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135,230,175 (GRCm38)	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135,239,778 (GRCm38)	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135,251,528 (GRCm38)	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135,251,544 (GRCm38)	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135,238,138 (GRCm38)	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135,243,822 (GRCm38)	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135,235,127 (GRCm38)	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135,235,202 (GRCm38)	missense	probably benign	0.02
R7009:Cenpe	UTSW	3	135,235,201 (GRCm38)	missense	probably damaging	0.97
R7039:Cenpe	UTSW	3	135,255,456 (GRCm38)	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135,247,037 (GRCm38)	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135,242,155 (GRCm38)	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135,243,762 (GRCm38)	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135,248,634 (GRCm38)	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135,247,459 (GRCm38)	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135,242,302 (GRCm38)	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135,247,335 (GRCm38)	splice site	probably null
R7771:Cenpe	UTSW	3	135,240,941 (GRCm38)	splice site	probably null
R7843:Cenpe	UTSW	3	135,232,959 (GRCm38)	nonsense	probably null
R7973:Cenpe	UTSW	3	135,223,250 (GRCm38)	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135,239,848 (GRCm38)	frame shift	probably null
R8069:Cenpe	UTSW	3	135,243,718 (GRCm38)	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135,247,022 (GRCm38)	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135,230,090 (GRCm38)	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135,251,614 (GRCm38)	missense	probably benign
R8425:Cenpe	UTSW	3	135,242,627 (GRCm38)	nonsense	probably null
R8488:Cenpe	UTSW	3	135,259,241 (GRCm38)	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135,223,240 (GRCm38)	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135,225,016 (GRCm38)	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135,260,101 (GRCm38)	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135,239,883 (GRCm38)	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135,270,811 (GRCm38)	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135,218,036 (GRCm38)	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135,239,880 (GRCm38)	nonsense	probably null
R9221:Cenpe	UTSW	3	135,230,078 (GRCm38)	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135,248,446 (GRCm38)	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135,270,848 (GRCm38)	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135,216,385 (GRCm38)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGCAGGGCTTAACTCTGAGTAAG -3'
(R):5'- ACTGCTGAGCTGCAAAGACG -3'

Sequencing Primer
(F):5'- GGGCTTAACTCTGAGTAAGATAGAG -3'
(R):5'- GATTCTAGCCATTGCAGGTACCAG -3'

Posted On

2020-07-28