Incidental Mutation 'R0095:Hnrnpa3'
ID64024
Institutional Source Beutler Lab
Gene Symbol Hnrnpa3
Ensembl Gene ENSMUSG00000059005
Gene Nameheterogeneous nuclear ribonucleoprotein A3
SynonymsHnrpa3, 2610510D13Rik, 2410013L13Rik, 2610209F03Rik
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R0095 (G1)
Quality Score87
Status Not validated
Chromosome2
Chromosomal Location75659261-75669407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75661696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 52 (R52L)
Ref Sequence ENSEMBL: ENSMUSP00000126069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090792] [ENSMUST00000111961] [ENSMUST00000111962] [ENSMUST00000111964] [ENSMUST00000141974] [ENSMUST00000164947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090792
AA Change: R74L

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088298
Gene: ENSMUSG00000059005
AA Change: R74L

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
RRM 36 108 4.06e-24 SMART
RRM 127 199 1.94e-21 SMART
low complexity region 211 338 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111961
AA Change: R74L

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107592
Gene: ENSMUSG00000059005
AA Change: R74L

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
RRM 36 108 4.06e-24 SMART
RRM 127 199 1.94e-21 SMART
Pfam:HnRNPA1 266 303 8.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111962
AA Change: R52L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107593
Gene: ENSMUSG00000059005
AA Change: R52L

DomainStartEndE-ValueType
RRM 14 86 4.06e-24 SMART
RRM 105 177 1.94e-21 SMART
low complexity region 189 316 N/A INTRINSIC
low complexity region 327 356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111964
AA Change: R74L

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107595
Gene: ENSMUSG00000059005
AA Change: R74L

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
RRM 36 108 4.06e-24 SMART
RRM 127 199 1.94e-21 SMART
low complexity region 211 338 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132392
Predicted Effect probably benign
Transcript: ENSMUST00000141974
SMART Domains Protein: ENSMUSP00000116125
Gene: ENSMUSG00000059005

DomainStartEndE-ValueType
PDB:2UP1|A 1 25 7e-8 PDB
low complexity region 26 153 N/A INTRINSIC
low complexity region 164 193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164947
AA Change: R52L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126069
Gene: ENSMUSG00000059005
AA Change: R52L

DomainStartEndE-ValueType
RRM 14 86 4.06e-24 SMART
RRM 105 177 1.94e-21 SMART
low complexity region 189 316 N/A INTRINSIC
low complexity region 327 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175501
Meta Mutation Damage Score 0.3504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Hnrnpa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Hnrnpa3 UTSW 2 75661696 missense probably damaging 1.00
R4583:Hnrnpa3 UTSW 2 75663606 missense probably benign 0.23
R4762:Hnrnpa3 UTSW 2 75662007 missense possibly damaging 0.95
R5499:Hnrnpa3 UTSW 2 75665240 missense probably benign 0.23
R5802:Hnrnpa3 UTSW 2 75665056 missense unknown
R6253:Hnrnpa3 UTSW 2 75662570 missense possibly damaging 0.82
R8233:Hnrnpa3 UTSW 2 75662516 missense probably benign 0.04
R8437:Hnrnpa3 UTSW 2 75662675 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCAGGGCCATGATCCAAAGGAAC -3'
(R):5'- GGCACCAGGCTTTACAGAATCCTAC -3'

Sequencing Primer
(F):5'- GGTCTGAGCTTTGAAACCAC -3'
(R):5'- AAACAGCTCTCTTCGGTTCCAC -3'
Posted On2013-08-06